michaela
Uploaded by
46 SLIDES
764 VUES
470LIKES

DNA & Protein Synthesis

DESCRIPTION

DNA & Protein Synthesis. From Gene to Protein. Nucleic Acids and Protein Synthesis. All functions of a cell are directed from some central form of information (DNA). This "biological program" is called the Genetic Code .

1 / 46

Télécharger la présentation

DNA & Protein Synthesis

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. DNA & Protein Synthesis From Gene to Protein

  2. Nucleic Acids and Protein Synthesis • All functions of a cell are directed from some central form of information (DNA). • This "biological program" is called the Genetic Code. • This is the way cells store information regarding their structure and function.

  3. History of DNA Composition and Structure

  4. History • For years the source of heredity was unknown. This was resolved after numerous studies and experimental research by the following researchers: • Fredrick Griffith • He was studying effects of 2strains of an infectious bacteria, the "smooth" strain was found to cause pneumonia & death in mice. The "rough" strain did not. He conducted the following experiment

  5. Griffith Experiment • The last condition was unusual, as he predicted that the mouse should live • Concluded that some unknown substance was Transformingthe rough strain into the smooth one

  6. Avery, McCarty & MacLeod Tried to determine the nature of this transforming agent. • Was it protein or DNA? • They Degraded chromosomes with enzymes that destroyed proteins or DNA • The Samples with Proteins destroyed would still cause transformation in bacteria indicating genetic material was DNA

  7. Hershey-Chase • ONE virus was radioactively "tagged" with 32P on it's DNA • The OTHER was "tagged" 35S on it's protein coat. • Researchers found the radioactive P in the bacteria, indicating it is DNA, not protein being injected into bacteria.

  8. Watson & Crick • The constituents of DNA had long been known. Structure of DNA, however was not. • In 1953, Watson & Crick published findings based on X-ray analysis (Rosalind Franklin) and other data that DNA was in the form of a "Double Helix". • Their findings show us the basic structure of DNA which is as follows.

  9. DNA Structure The Double Helix

  10. DNA Structure DNA is Formed of in a "Double Helix" - like a spiral staircase

  11. Nucleotides • DNA is formed by Nucleotides • These are made from three components: • 5-Carbon or pentose Sugar • Nitrogenous base • Phosphate group

  12. Types of Nucleotides • For DNA There are 4 different Nucleotides categorized as either Purines(Double rings) or Pyrimidines (Single ring). These are usually represented by a letter. They Are: • Adenine (A) • Cytosine (C) • Guanine (G) • Thymine (T) Guanine

  13. Base Pairing • Each "Rung" of the DNA "staircase" is formed by the linking of 2 Nucleotides through Hydrogen Bonds. • These Hydrogen bonds form only between specific Nucleotides. This is known as Base Pairing. The rules are as follows: • Adenine (A) will ONLY bond to Thymine (T) (by 2 hydrogen bonds) • Cytosine (C) will ONLY bond to Guanine (G) (by 3 hydrogen bonds)

  14. Central Dogma of Genetics DNA to Protein Synthesis

  15. Central Dogma of Genetics • Central Dogma holds that genetic information is expressed in a specific order. This order is as follows There are some apparent exceptions to this. Retroviruses (eg. HIV) are able to synthesize DNA from RNA

  16. DNA Replication • DNA has unique ability to make copies of itself • The process is called DNA Replication. • First, the enzyme Helicase unwinds the parental DNA • DNA "Unzips itself" by breaking the weak hydrogen bonds between base pairs forming two TEMPLATE strands with exposed Nucleotides

  17. DNA Replication • The place where helicase attaches and opens DNA is called the Replication Fork REPLICATION FORK

  18. DNA Replication • Helicase enzymes may attach to multiple sites on the DNA strand forming Replication Bubbles which makes replication faster

  19. DNA Replication • Single-strand binding proteins attach & STABILIZE the 2 parental strands • DNA polymerase attaches to the 3’ end of the 5’ to 3’ parental strand • DNA polymerase attaches FREE nucleotides to the complementary nucleotide on the parental DNA • This new strand is synthesized continuously 5’ to 3’ (LEADING)

  20. Replication Bubble • DNA is synthesized from the Origin of Replication within a replication bubble • Towards fork – continuous replication • Away from fork – discontinuous replication (fragments) Origin of Replication Origin of Replication

  21. DNA Replication Since DNA polymerase can only add nucleotides to the 3’ end of the parental strand, the parental 5’ to 3’ strand must be replicated in fragments that must later be joined together (LAGGING)

  22. DNA Replication • Transcription proceeds continuously along the 5'3' direction (This is called the leading strand) • Proceeds in fragments in the other direction (called the lagging strand) in the following way • RNA primer is attached to a segment of the strand by the enzyme primase.

  23. DNA Replication • Transcription now continues in the 5'3' direction forming an okazakifragment. Until it reaches the next fragment. • The two fragments are joined by the enzyme DNA ligase • Two, new, identical DNA strands are now formed

  24. DNA Replication

  25. Protein Synthesis Transcription and Translation

  26. RNA Transcription • The cell does not directly use DNA to control the function of the cell. • DNA is too precious and must be kept protected within the nucleus. • The Cell makes a working "Photocopy" of itself to do the actual work of making proteins. • This copy is called Ribonucleic Acid or RNA. • RNA differs from DNA in several important ways. • It is much smaller • It is single-stranded • It does NOT contain Thymine, but rather a new nucleotide called Uracil which will bind to Adenine • Contains ribose, not deoxyribose sugar

  27. RNA Transcription • RNA is produced through a process called RNA Transcription. • Similar to DNA Replication. • Small area of DNA "Unzips" exposing Nucleotides • This area is acted on by an enzyme called RNA Polymerase, which binds nucleotides (using uracil) to their complementary base pair. • This releases a long strand of Messenger RNA (mRNA) which is an important component ofprotein synthesis.

  28. RNA Transcription

  29. Protein Synthesis & The Genetic Code • The Sequence of nucleotides in an mRNA strand determine the sequence of amino acids in a protein • Process requires mRNA, tRNA & ribosomes • Polypeptide chains are synthesized by linking amino acids together with peptide bonds

  30. mRNA • Each three Nucleotide sequence in an mRNA strand is called a "Codon“ • Each Codon codes for a particular amino acid. • The codon sequence codes for an amino acid using specific rules. These specific codon/amino acid pairings is called the Genetic Code.

  31. tRNA • There is a special form of RNA called Transfer RNA or tRNA. • Each tRNA has a 3 Nucleotide sequence on one end which is known as the "Anitcodon" • This Anticodon sequence is complimentary to the Codon sequence found on thestrand of mRNA • Each tRNA can bind specifically with a particular amino acid.

  32. Ribosome • Consists of two subunits made of protein & rRNA • Large subunit • Small subunit • Serves as a template or "work station" where protein synthesis can occur.

  33. Protein Synthesis • First, an mRNA strand binds to the large & small subunits of a ribosome in the cytosol of the cell • This occurs at the AUG (initiation) codon of the strand. • The ribosome has 3 binding sites for codons --- E (exit site), P, and A (entry site for new tRNA) • The ribosome moves along the mRNA strand

  34. Protein Synthesis • An anticodon on tRNA binds to a complementary codon on mRNA. • The tRNA carrying an amino acid enters the A site on the ribosome • The ribosome moves down the mRNA so the tRNA is now in the P site and another tRNA enters the A site • A peptide bond is formed between the amino acids and the ribosome moves down again • The first tRNA is released, and another tRNA binds next to the second, another peptide bond is formed. • This process continues until a stop codon (UAG…) is reached. • The completed polypeptide is thenreleased.

  35. Protein Synthesis

  36. Replication Problem • Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary strand? • 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’

  37. Answer • Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary strand? • 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’ • 5’- ATGGTGCACCTGACTCCTGAGGAGAAGTCT -3’

  38. RNA Transcription Problem • Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary mRNA strand? • 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’

  39. ANSWER • Given a DNA strand with the following nucleotide sequence, what is the sequence of its complimentary mRNA strand? • 3’- TACCACGTGGACTGAGGACTCCTCTTCAGA -5’ • 3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’

  40. Codon / Anticodon • Given a mRNa strand with the following nucleotide sequence, what are the sequence (anticodons) of its complimentary tRNA strands? • 3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’

  41. Answer Given a mRNA strand with the following nucleotide sequence, what are the sequence (anticodons) of its complimentary tRNA strands? • 3’- AUGGUGCACCUGACUCCUGAGGAGAAGUCU -5’ • 3’ – UACCACGUGGAUGAGGACUCCUCUUCAGA -5’

  42. Protein Translation • Given the following sequence of mRNA, what is the amino acid sequence of the resultant polypeptide? • AUGGUGCACCUGACUCCUGAGGAGAAGUCU

  43. Protein Translation / Answer • Given the following sequence of mRNA, what is the amino acid sequence of the resultant polypeptide? • AUGGUGCACCUGACUCCUGAGGAGAAGUCU Met-val-his-leu-thr-pro-glu-glu-lys-ser

More Related