minna
Uploaded by
16 SLIDES
560 VUES
190LIKES

Mapping NGS sequences to a reference genome

DESCRIPTION

Mapping NGS sequences to a reference genome. Why?. Resequencing studies (DNA) Structural variation SNP identification RNAseq Mapping transcripts to a genome sequence Genome annotation Transcript enumeration Identification of splice junctions/variants. Blast is too slow.

1 / 16

Télécharger la présentation

Mapping NGS sequences to a reference genome

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. Mapping NGS sequences to a reference genome

  2. Why? • Resequencing studies (DNA) • Structural variation • SNP identification • RNAseq • Mapping transcripts to a genome sequence • Genome annotation • Transcript enumeration • Identification of splice junctions/variants

  3. Blast is too slow • Different alignment algorithms are necessary • Burrows Wheeler Alignment • sequence database (genome) is transformed to produce an index • Individual sequence reads are searched against this index • STAR Aligner (Dobin et al. 2012) Bioinformatics • Uncompressed Suffix trees

  4. BWT of “banana”

  5. Tophat2 • Based on the Bowtie alignment engine • Bowtie, matching with no gaps • Tophat2, gapped matches • Aligns reads to a Burrows Wheeler transformed index of the genome • 1st pass  non-gapped matches • 2nd pass  splits unmapped reads and attempts to align the fragments

  6. The STAR Aligner • Start at the first base of sequence read • Find Maximal Mappable Prefix (MMP) • Repeat process using unmapped portion of read • 50x faster than other aligners

  7. OUTPUTS • TopHat (Bowtie) • .bam file (binary alignment/map) • .sam (sequence alignment/map) • Single .sam file entry: I8MVR:53:837 0 17_dna:chromosome 14090858 255 21M * 00 TAACTACGAATACCTGTCGAT **%-**,00%-*-%---*-*- NM:i:7 XX:Z:C5T3C2T2CT2C XM:Z:h..H......h.H...x...h XR:Z:CT XG:Z:CT

  8. .sam fields

  9. .sam flags • 1 • 2 • 1+2 • 0+4 • 1+4 • 0+2+4 • 1+2+4 • 0+8 • 1+8 • 0+2+8 • 1+2+8 • 0+4+8 • 1+4+8 • 0+2+4+8 • 1+2+4+8 • …etc.

  10. CIGAR format I8MVR:104:144 0 7_dna:chromosome120102744 255 62M1I14M * 00 GGTTTTTTGGAAGAGTAGTTCGCGTTTCATTAATTAGTTATTTTTTAGTTTTTAAATAAAATAAAATTTTAAAAAAA

  11. Quantifying alignments • How many reads overlap a given interval on a chromosome (scaffold)? • How do these regions correspond to known genes? • .gtf file • How many transcripts from my gene of interest? • How confident can I be about a variant call?

  12. Annotate regions - GTF files • Score • Strand • Frame • Attribute GTF fields • Sequence ID • Source • Feature • Start • End

  13. Variant Calling • .bam/.sam file contains all of the information required to call variants • Variant calls can’t be extracted from the .bam file • Must provide the genome sequence I8MVR:53:837 0 17_dna:chromosome 14090858 255 21M * 0 0 TAACTACGAATACCTGTCGAT **%-**,00%-*-%---*-*- NM:i:7 XX:Z:C5T3C2T2CT2C XM:Z:h..H......h.H...x...h XR:Z:CT XG:Z:CT

  14. Today’s exercises

  15. Variant Analysis • Extract variant information from provided .bam file • Examine output file and learn about the information contained in the various fields

  16. Introducing… Dr. Eric Rouchka • Bioinformatics Core Director • Department of Computer Engineering and Computer Science • University of Louisville • Kentucky Biomedical Research Infrastructure Network

More Related