berget
Uploaded by
52 SLIDES
1268 VUES
610LIKES

Mapping the Human Genome

DESCRIPTION

Mapping the Human Genome. Genetic Mapping. Physical Mapping. DNA Sequencing. Physical Mapping Systems. Yeast Artificial Chromosomes (YACs) 200-2000 kb. Bacteriophage P1 90 kb. Cosmids 40 kb. Bacteriophage l 9-23 kb. Large Fragment Cloning.

1 / 52

Télécharger la présentation

Mapping the Human Genome

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Mapping the Human Genome Genetic Mapping Physical Mapping DNA Sequencing

  2. Physical Mapping Systems Yeast Artificial Chromosomes (YACs) 200-2000 kb Bacteriophage P1 90 kb Cosmids 40 kb Bacteriophage l9-23 kb

  3. Large Fragment Cloning --- Hybrid cells : multiple chromosomes : 100 -3000 Mbp --- Mono-chromosomal hybrids : 50- 300Mbp --- Sub-chromosomal hybrids : 1-50 Mbp --- Double-minutes : 0.3-2 Mbp --- Yeast Artificial Chromosomes : YACs : 0.05-2 Mbp --- BACs (F-plasmid derived) : - 300 kb --- PACs (large P1 clones) : - 300 kb Insert Size --- T4-packaging system : - 120 kb ( - 300 kb) --- EBV derived vectors : - 180 kb --- P1 + P1 packaging : - 80- 90 kb --- Cosmid vectors : 35 - 45 kb --- Lambda replacement vectors : 8 - 22 kb --- Micro-dissection clones : - 1.5 kb

  4. Bacteriophage Lambda • Insertion Vectors • cDNA cloning and expression GT10, GT11, Zap • Replacement Vectors • Genomic cloning EMBL3, EMBL 4

  5. Lambda gt11 • Insertion vector • Small inserts (cDNAs) • Expression cloning

  6. Lambda Zap • Insertion vector • Small inserts (cDNAs) • Expression cloning • In vivo excision of inserts

  7. Lambda Fix • Replacement vector • Larger inserts • Genomic DNA • Spi selection

  8. Lambda EMBL3 • Replacement vector • Larger inserts • Genomic DNA • Spi selection

  9. (1) Sort tubes are spun at 3 K rpm for 2 hours at 4 degrees Celsius. (2) The resulting pellet is extracted with Proteinase K/SDS; the sort tube is also extracted to isolate chromosomes adhering to the side of the tube. (3) Both samples are Phenol/CHCl3 extracted and dialyzed overnight. SORTED CHROMOSOME ISOLATION PROCEDURE Use for purity 1% analysis of DNA and quantitation Proteinase K/SDS SUPERNATANT Phenol / CHCl3 Extract Clone into ==> 75-85% Lawrist of DNA Vector Proteinase K/SDS PELLET Phenol / CHCl3 Extract & Dialyze SORT TUBE spun @ 3K rpm Clone into ==> 14-24% Charon of DNA Vector Proteinase K/SDS SORT TUBE Phenol / CHCl3 Extract & Dialyze

  10. SOURCE DNA FOR CLONING Grow cell (e.g. hybrid cells: J640-51) Isolate chromosomes by flow-sorting Purify chromosomes using described protocol Partial digest with MboI / dephosphorylate CONSTRUCTION OF LARGE INSERT LAMBDA LIBRARIES Charon 40 Vector (9 - 23 kb capacity) Polystuffer R arm L arm cos cos BamHI BamHI (1) Nae 1 (2) PEG precipitation (3) Phenol, chloroform extraction (4) Ethanol precipitation (5) BamHI BamHI Polystuffer R arm L arm cos cos Plate the Lambda library and screen with probes to identify phage which contain sequences of interest BamHI BamHI Ligate Ba Ba Package Amplify on E. Coli host strain K802 (rec A-) Characterize Before Distribution to (ATCC)

  11. Cosmids and Fosmids • Cosmids • High-copy number replicon • Limited size based on packaging reactions • Chromosome-specific libraries • Fosmids • Low-copy replicon (F factor) • Limited size based on packaging reactions • Chromosome-specific libraries

  12. pFOS1 : F-replicon based cosmid vector AatII cos HindIII cos cos cos BamHI cos HindIII AatII CM 1 pFOS1 9.5 kb pUCcos1 BamHI pBAC CM parB pUCcos1 oriS parB parA repE oriS 2 parA repE AatII BamHI BamHI AatII Kim, U-J., Shizuya,H, de Jong,P.J., Birren,B., Simon,M., Nucleic Acids Research 1992, 20, 1083-1085

  13. SfiI site #1 Use of SfiI sites for differential end-labeling of insert ends as part of restriction mapping. Labeling by ligating oligo-adapters to ends. 5’-GGCCGAAACGGCC-3’ 3’-CCGGCTTTGCCGG-5’ AAA SfiI site #2 VECTOR FRAGMENT GGG 5’-GGCCGCCCCGGCC-3’ 3’-CCGGCGGGGCCGG-5’ CCC TTT INSERT FRAGMENT B B B cos LAMBDA ORIGIN COSMID VECTORS (DE JONG ET AL) WITH TWO COS SITES DERIVED FROM LORISTX(P.F.R. LITTLE) amp neo ScaI AatII LAWRIST “n” 8.2 kb cos #1 SfiI #2 SfiI l ori VECTOR: CLONING SITES: USE FOR CLONING OF: T7 SP6 H LAWRIST5 LAWRIST6 LAWRIST7 LAWRIST8 LAWRIST16 H = HindIII B = BamHI Partial HindIII or partial MboI digests S S = SalI B = BamHI Partial MboI digest, using partial fill-in of MboI and SalI (vector) sites Ss N N = NotI Ss = SstI (Partial MboI + complete NotI or SstII) digests M B M = Mlul B = BamHI (Partial MboI + complete Mlul) digets T7 T3 H B H = HindIII B = BamHI Partial HindIII or partial MboI digests For cosmid protocols: “Choice and use of cosmid vectors”, by Peter F.R. Little, in “DNA cloning, Volume 3” (Ed. D.M.Glover, IRL Press, 1987), 19-42 Please note that the neo marker only contains a prokaryotic promoter. Hence, the cosmids can not be selected with G418 upon transfection into mammalian cells.

  14. (1) Sort tubes are spun at 3 K rpm for 2 hours at 4 degrees Celsius. (2) The resulting pellet is extracted with Proteinase K/SDS; the sort tube is also extracted to isolate chromosomes adhering to the side of the tube. (3) Both samples are Phenol/CHCl3 extracted and dialyzed overnight. SORTED CHROMOSOME ISOLATION PROCEDURE Use for purity 1% analysis of DNA and quantitation Proteinase K/SDS SUPERNATANT Phenol / CHCl3 Extract Clone into ==> 75-85% Lawrist of DNA Vector Proteinase K/SDS PELLET Phenol / CHCl3 Extract & Dialyze SORT TUBE spun @ 3K rpm Clone into ==> 14-24% Charon of DNA Vector Proteinase K/SDS SORT TUBE Phenol / CHCl3 Extract & Dialyze

  15. SOURCE DNA FOR CLONING Grow cell (e.g. hybrid cells: J640-51) Isolate chromosomes by flow-sorting Purify chromosomes using described protocol Partial digest with MboI / dephosphorylate ScaI ScaI BamHI BamHI cos cos ScaI 1 2 3 4 5 6 7 8 9 10 11 12 cos cos A B C D E F G H BamHI BamHI cos CONSTRUCTION OF CHROMOSOME-ENRICHED COSMID LIBRARY amp cos neo ScaI LAWRIST 16 Vector cos l ori BamHI Prepare : (1) Digest vector with excess ScaI Vector (2) Dephosphorylate the ScaI ends with excess CIAP Arms (3) Digest the cloning site with BamHI Pick clones into microtiter plates, grow, and determine percentage of human clones (hybridize to total human and total hamster DNA probes) ScaI Infect host DH5aMCR Kanamycin plate

  16. Bacteriophage P1 • Insertion Vectors • Large Inserts • Limited to “HEADFULL” • Packaging reaction followed by plasmid propagation

  17. S S loxP B B loxP kan pac P1 vector for the construction of recombinants by P1 packaging loxP P1 plasmid replicon Ad2 Sca 1 pAD10SacBII (30kb) kan pBR322 ori pac sacB loxP P1 lytic replicon Sp6 T7 E.coli promoter sacB c 1 repressor binding site BamH 1 Not 1 Sfi 1 Pierce et al, Proc. Natl. Acad. Sci.U.S.A. (1992) 89, 2056-2060

  18. S B loxP B loxP kan Constructing P1 recombinants using packaging extracts insert of 80-90 kb pac S packaging B loxP B loxP kan site-specific recombination loxP

  19. pac S S B loxP B loxP kan Implications of particle size for P1 recombinant viability “HEADFULL” YARD STICK (110-115 kb) insert too large maximal insert min. insert insert too small first cut during packaging reaction

  20. P1 Derived Artificial Chromosomes (PACs) • Electroporation Based System • Large insert size • Low copy number origin for propagation • High copy origin for DNA production • Negative selection against non-recombinants • Very stable inserts

  21. BamHI HindIII EcoRI HindIII B S S EcoRI S S lacZa lacZa amp amp pUC19 pUC19-link Preparation of pUC19-link XbaI PmeI BamHI ScaI GATCTAGAGTACTGGGTTTAAACCCGGATCCGGGTTTAAACCCAGTACTCTA ATCTCATGACCCAAATTTGGGCCTAGGCCCAAATTTGGGTCATGAGATCTAG ScaI XbaI PmeI Oligonucleotide adapter LL171

  22. P1 vector for the construction of recombinants by electroporation loxP loxP plasmid replicon pCYPAC1 (19.3 kb) plasmid replicon kan 1 2 P1 lytic replicon pAD10SacBII (30kb) S S kan pac sacB pac P1 lytic replicon loxP sacB loxP sacB loxP B pUC19-link P B S B B B S pUC19-link B B S S S 1. Insert BamHI-digested pUC19-link into BamHI site of P1 vector 2.Deletion of Ad2-fragment by in vivo site-specific recombination

  23. pCYPAC1 kan plasmid replicon P1 lytic replicon sacB loxP pUC19-link B S S B S Preparation of vector for cloning B B kan 1 S S S S B S B S 2 B B kan S S S S 1 Digest with BamHI and ScaI 2 Dephosphorylate and remove linkers (Centricon)

  24. Sizing of MboI partial-digest fragments CHEF gel electrophoresis 1 2 NOT stained stained stained 2 5 1 3 4 1 correct size fraction identified (150-250kb) 4 3 2 3 4 5 for analysis for ligation

  25. Bacterial Artificial Chromosomes (BACs) • Electroporation Based System • Large insert size • Low copy number origin for propagation • Very stable inserts

  26. Yeast Artificial Chromosomes • Large Inserts • Not Stable • Chimeric inserts

  27. Problems with YACs! 1) Approximately 40-60% of the YACs from most libraries are chimeric. 2) Approximately 40 % of the YACs from most libraries are deleted. 3) Low transformation efficiencies. 4) YACs are very difficult to manipulate.

  28. Physical Mapping Systems Yeast Artificial Chromosomes (YACs) 200-2000 kb Bacteriophage P1 90 kb Cosmids 40 kb Bacteriophage l9-23 kb

  29. YAC 34 170 2,667 Question of Size? Vector Human Genome Chromosome 19 1X 5X 1X 5X 13,335 44,445 2,780 222,225 556 P1 Cosmid 1,251 6,255 100,002 500,010

  30. Storage Space? Vector Human Genome Chromosome 19 1X 5X 1X 5X YAC 1 2 28 139 463 29 2,315 6 P1 Cosmid 14 66 1,042 5,209

  31. Advantages of BACs & PACs 1) Bacterial based systems that are easy to manipulate. 2) Libraries are generated using bacterial hosts with well defined properties. 3) Transformation efficiency is higher than that obtained for YACs. 4) BACs and PACs are non-chimeric, very stable and do not delete sequences.

  32. Comparison of BACs & PACs 1) Both allow replication of clones at one copy/cell. 2) Both systems replicate clones faithfully across 60-100 generations. 3) PACs also have a negative selection against non-recombinants. 4) PACs have an IPTG inducible high copy number origin of replication.

  33. Closure of Chromosome 19 • Type of Approach • A) Bacterial Artificial Chromosomes (BACs). • B) P1 Artificial Chromosomes (PACs). • C) Yeast Artificial Chromosomes (YACs). • D) Cosmids. • E) All of the above.

More Related