odetta
Uploaded by
32 SLIDES
527 VUES
350LIKES

The Human Genome

DESCRIPTION

This analysis delves into the composition and structure of the human genome, highlighting its 3 billion base pairs. Key findings include that nearly half of the genome consists of repeats, and only about 1.5% is known coding genes. The study explores the functional fraction of the genome, jumping genes, and the complexity introduced by alternative splicing. Notably, the initial sequencing data showcases significant gene density variations across chromosomes and raises questions about the organizational intricacies of our genetic material.

1 / 32

Télécharger la présentation

The Human Genome

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. The Human Genome 3000000000 bases

  2. The raw data agcattaacatcaacacagattttcagatcttaggtttctttccgatcta ttctctctgaaccctgctacctggaggcttcatctgcataataaaacttt agtctccacaaccccttatcttaccccagacattcctttctattgataat aactctttcaaccaattgccaatcagggtatgtttaaatctacctatgac ctggaagcccccactttgcaccctgagatcaaaccagtgcaaatcttata tgtattgatttgtcAATGAAAACAGTCAAAGCCagtcaggcacagtggct catgcctgtaatcccagcactttgggaggctgaggcgggtagatcacctg aggtcaggagttcgacaccagcctggccaacatggtgaaaccccgtccct actaaaatacaaaaattagcccagcttggtggtgggcacctgtaatctta gctactgcagagactgaggcaggagaatcgcttgaacccaggaggtggag gttgcagtgacctgagattttgccattgcactccagcctgggcaacagag caagactctatctcaaaaaacaaacaaacaaacaaacaaacaaacaaacT gtcaaaatctgtacagtatgtgaagagatttgttctgaaccaaatatgaa tgaccatggtccatgacacagccctcagaagaccctgagaacatgtgccc aaggtggtcacagtgcatcttagttttgtacattttagggagatatgaga cttcagtcaaatacatttttaaaaaatacattggttttgtccagaaagcc agaaccactcaaagcaggggtttccaggttataagtagatttaaaatttt tctgattgacaattggttgaaagagttgtcaatagaaaggaatgtctgca ttgtgacaagaggttgtggagaccaagtttctgtcatgcagatgaagcct tcaggtagcaggcttccaagataacaggttgtaaatagttcttatcagac ttaaGTTCTGTGGAGACGTAAAATGAGGCATATCTGACCTCCACTTccaa aaacatctgagacaggtctcagttaattaagaaagtttgttctgcctagt ttaaggacatgcccatgacactgcctcaggaggtcctgacagcatgtgcc caaggtggtcaggatacagcttgcttctatatattttagggagaaaatac atcaGCCtgtaaacaaaaaattaaattctaaggtccctgaaccatctgaa tgggctttcttctaggccagggcactctaaaattgaagaacctgaacatt cctttctattgataatactttcagccagttgagcccattcagaCCACAGC AAGGTGCCAGGCCAGGCAAGGGCTGACTTGAGATACCTGCCAGATGAGTC ACTGGCAAAAGGTGCTGCTCCCTGGTGAGGGAGAAACACCAGGGGCTGGG AGAGGCCCAGAAGGCTCTGAAGGAGTTTTGGTTTGGCTGGCCATGTGTGC AATTAGCGTGATGAGCTCTGACATGGCCTTGCATGGACGGATTGGGCAGG NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN GATCTGATAAGTCCCAGGACTTCAGAAGagctgtgagaccttggccaagt cacttcctccttcagGAACATTGCAGTGGGCCTAAGTGCCTCCTCTCGGG ACTGGTATGGGGACGGTCATGCAATCTGGACAACATTCACCTTTAAAAGT TTATTGATCTTTTGTGACATGCACGTGGGTTCCCAGTAGCAAGAAACTAA AGGGTCGCAGGCCGGTTTCTGCTAATTTCTTTAATTCCAAGACAGTCTCA AATATTTTCTTATTAACTTCCTGGAGGGAGGCTTATCATTCTCTCTTTTG GATGATTCTAAGTACCAGCTAAAATACAGCTATCATTCATTTTCCTTGAT TTGGGAGCCTAATTTCTTTAATTTAGTATGCAAGAAAACCAATTTGGAAA TATCAACTGTTTTGGAAACCTTAGACCTAGGTCATCCTTAGTAAGATctt cccatttatataaatacttgcaagtagtagtgccataattaccaaacata aagccaactgagatgcccaaagggggccactctccttgcttttcctcctt tttagaggatttatttcccatttttcttaaaaaggaagaacaaactgtgc cctagggtttactgtgtcagaacagagtgtgccgattgtggtcaggactc catagcatttcaccattgagttatttccgcccccttacgtgtctctcttc agcggtctattatctccaagagggcataaaacactgagtaaacagctctt ttatatgtgtttcctggatgagccttcttttaattaattttgttaaggga tttcctctagggccactgcacgtcatggggagtcacccccagacactccc aattggccccttgtcacccaggggcacatttcagctAtttgtaaaacctg aaatcactagaaaggaatgtctagtgacttgtgggggccaaggcccttgt tatggggatgaaggctcttaggtggtagccctccaagagaatagatggtg Aatgtctcttttcagacattaaaggtgtcagactctcagttaatctctcc tagatccaggaaaggcctagaaaaggaaggcctgactgcattaatggaga ttctctccatgtgcaaaatttcctccacaaaagaaatccttgcagggcca ttttaatgtgttggccctgtgacagccatttcaaaatatgtcaaaaaata tattttggagtaaaatactttcattttccttcagagtctgctgtcgtatg atgccataccagagtcaggttggaaagtaagccacattatacagcgttaa cctaaaaaaacaaaaaactgtctaacaagattttatggtttatagagcat gattccccggacacattagatagaaatctgggcaagagaagaaaaaaagg tcagagtttaatcctcaTTCCTAAGTTAtgtaaaccaaaaataaaattct gaagatgtcctgatcatctgaatggacccttcctctggaccagggcattc caaagttaacctgaaaattggtttgggccatgatgggaagggaggtttgg atatgcctcattatgccctcttccctttcagaattcaggaaaagccaacc A’s T’s C’s and G’s and N’s

  3. Composition of the human genome • Nearly half the genome is repeats • Only approximately 1.5% is known coding genes • Unknown functional fraction?!

  4. The repeat content Jumping -genes • Transposition-derived repeats • Inactive retroposed cellular genes. • Simple repeats - microstats • Segmental duplications • Tandom repeats (telomere, centromere)

  5. Few than expected genes GeneSweep – Ewan Birney (Welcome Trust Sanger Institute) The happy winner. Lee Rowen of the Institute for Systems Biology. 25,947 genes.

  6. Genome complexity Alternative splicing 56% for Humans 22% for Worms Regulators elements Promoters, enhancers, repressors… This is where it get complicated.

  7. Variation among chromosomes Initial sequencing and analysis of the human genome International Human Genome Sequencing Consortium Nature409, 860 - 921 (15 February 2001) • Overall recombination rate dependent on chromosome length. • Large variation in the gene density between chromosome. • Difference in organisation

  8. Variation within chromosomes Recombination GC Gene density The genome is non-random in its organisation Recombination – High at telomere GC – Variation at many scales - Isochores Gene Density – Organisation by function

  9. New observations 2001 • Variation at multiple scales within and between chromosomes • Only twice as many genes as flies and worms – but more proteins • Genes have arrived from bacteria and transposable elements • Transposons inactive and LTR probably also (Alu’s in GC rich regions) • Most mutations occur in males (higher mutation rate) • GC poor regions correspond to dark bands. • Recombination rates are higher at telomeres • Lots of between individual variation

  10. Completing the Human Genome Humans Genome Project starts 1990 Draft Human Genome completed 2001 Fewer gaps 147,821 341 More continuity 81kb 38,500kb Gene rich regions completed 2003 Each chromosome compiled and annotated. 2006! Go home? • Error rate of ~1 in per 100,000 bases • 2.85 billion bases • Covers ~99% of the euchromatic genome.

  11. Not quite finished New builds: Build 36, May 2006 Build 35, May 2004 Build 34, July 2003 Build 33, April 2003 December 2001 - NCBI 28 July 2003 - NCBI 34

  12. Chromosome 1 • Segmental duplications • - allow genes to diversify and acquire novel functions. • Duplication of a gene from one to many positions on the chromosome. • A pericentric inversion follows a duplication of two genes

  13. Chromosomes 2 and 4 Gene deserts Megabase sized genomic segments containing no known coding genes. (some show conservation) Role of these regions? Lowest recombination rates of all the autosomes

  14. Chromosomes 3 Lowest rate of segmental duplication Large inversion from our ancestor with chimps.

  15. Chromosomes 7 Complex repeat patterns and fragile locations Williams-Beuren syndrome associated with a large deletion (1.6Mb). Lots of repetitive and duplicated DNA. What is the true sequences? “It is characterized by a distinctive, "elfish" facial appearance, along with a low nasal bridge; an unusually cheerful demeanor and ease with strangers, coupled with unpredictably occurring negative outbursts; mental retardation coupled with an unusual facility with language; a love for music; and cardiovascular problems, such as supravalvular aortic stenosis and transient hypercalcemia.”

  16. Chromosomes 10 Multi-species alignment – gene involved in cancer Conservation indicates the location of functional elements. Some are known genes. Others aren’t – higher levels of conservation!

  17. Chromosomes 19 Very high gene density Increase in all classes of known genes. 26 genes per megabase. What is special about this chromosome? Has high recombination rate. And repeat density And GC content.

  18. Chromosomes 12 and 3 Recombination rate variation Knowing the physical positions of variants allows recombination rates Male and female rates differ Fine scale variation

  19. Where is the data available • N.C.B.I.www.ncbi.nlm.nih.gov/genome/guide/human/ • Ensemblwww.ensembl.org/Homo_sapiens/ • UCSCgenome.ucsc.edu/cgi-bin/hgGateway • Part of the National Institute of Health. • Has a number of important associated projects. • Mr NCBI – David Lipman. • A joint project between EMBL and the Sanger Institute. • Primarily funded by the Welcome Trust. • Mr Ensembl – Ewan Birney • Based at the University of California Santa Cruz. • Largely funded by the NHGRI. • Mr UCSC – David Hassler

  20. What data available • Compositional • Base composition • Insertion deletions • Segmental duplications • Repeats • Transposable elements • Functional • Genes • Regulatory elements • Gene expression • Evolutionary • Species comparison • Variation data • Population genetic analysis

  21. Orientation • Human chromosomes are numbered • Arms are labelled p and q • Regions labelled ascending from centromere. • Bases numbered from beginning of small arm to end of long arm.

  22. Annotation - Repeats Transposable elements • Make up a large proportion of the genome Microsatellites and repeats • Important in many common diseases • Some of the most polymorphic loci

  23. Annotation - genes • mRNA evidence • Protein evidence • Gene prediction • EST evidence • Predicted transcripts • Known Novel • Manually annotated genes • Different levels of evidence for genes • Based on homology • Based on expression • Based on prediction

  24. Annotation – Expression and Regulation Expression Levels & Tissues Regulatory Elements • Regulatory elements might be important in complex diseases • Micro array technology is generating expression data on a large scale Expression varies in space and time

  25. Annotation – Evolutionary Cross Species (issues - alignment) (issues - ascertainment) Within Humans Variation is the most important feature of the genome!?

  26. Encylopedia of DNA Elements - Encode 1% of genome 14 manually chosen regions (Alpha & beta globin, HOXA, FOXP2 and CFTR) Plus 26 random regions • Variation group – SNPs indels • Function group – Promoters, transcription and binding • Chromatin group – Chromatin modification, replication origins • Multiple sequence alignment – Conservation vs Constraint • Aim: Understand everything possible about these regions.

  27. Human Variation SNPs – most common variation in the human genome 10 million common variants. Synonymous Non-synonymous variation Information in the density of SNPs. Information in the frequency of SNPs. Information in the correlation between SNPs.

  28. HapMap Project • 2002 HapMap phase I begins • Three populations • (YRI) Yoruba in Ibadan, Nigeria 90 • (CEU) Utah, USA 90 • (CHB) Han Chinese in Beijing 45 • (JPT) Japanese in Tokyo 44 • Approximately 1 million SNPs • 2005 Phase I complete, phase II begins • Increase from 1 million to ~ 4.6 million • 2006 Phase II complete, “phase III” begins • Additional 6 populations • Kenya, African Americans, Mexican Americans, Italy, India

  29. The International HapMap • Population genetic annotation is often sample specific • Linkage Disequilibrium information is an important tool

  30. Learing from studies of human variation • Can learn about how genetic diversity is structured across the globe • Identify regions which have been under recent positive selection • Identify recombination hotspots

  31. Hot Topics • Micro RNA’s • 20mers of RNA that form a diversity of roles – e.g. regulating mRNA levels • Structural variation • The genome of is full of polymorphic insertions and deletions, from 1kb to a Megabase • Genome-wide association studies • Millions of £s being spend on scanning the genome for loci showing association with disease status.

  32. Chromosomes X and Y Sex chromosomes

More Related