500 likes | 896 Vues
Genomics and the Future of Medicine. Fifth Annual Pharmacogenetics and Medicine Lecture June 14, 2002 Francis S. Collins, M.D., Ph.D. Fulfilling the Promise of Genomics for Better Health. Medical Genomics. Functional Genomics. Proteomics. Comparative Genomics.
E N D
Genomics and the Future of Medicine Fifth Annual Pharmacogenetics and Medicine Lecture June 14, 2002 Francis S. Collins, M.D., Ph.D.
Fulfilling the Promise of Genomics for Better Health Medical Genomics Functional Genomics Proteomics Comparative Genomics
Positional cloning of a gene for a highly penetrant Mendeliandisorder is now straightforward –but tracking genetic susceptibility factors for non-Mendelian disorders continues to be vexing
Linkage analysis Positive LOD score identified Fine mapping with SNPs Association identified Causative variant identified
HNF4A SLC2A10 PTPN1 Microsatellites
Linkage analysis Positive LOD score identified Fine mapping with SNPs Association identified Causative variant identified
Mass in Daltons GACCTGGAGCCCCCACC 5430.5 GACCTGGAGCCCCCACCC 5703.7 GACCTGGAGCCCCCACCTG 6047.9 Primer extension massspectrometry Primer extension reactions designed to generate different sized products C T primer
-LOG P for association: diabetics vs. elderly controls Gene A Association analysis in a region of linkage on 20q: fine mapping with SNPs
Association is much more powerful than linkage to identify common susceptibility variants N. Risch and S. Merikangas, Science 273: 1516-1517, 1996
Linkage analysis Positive LOD score identified Fine mapping with SNPs Association identified Causative variant identified
Fine mapping with SNPs Association identified Causative variant identified
Sequence from chromosome 7 GAAATAATTAATGTTTTCCTTCCTTCTCCTATTTTGTCCTTTACTTCAATTTATTTATTTATTATTAATATTATTATTTTTTGAGACGGAGTTTCACTCTTGTTGCCAACCTGGAGTGCAGTGGCGTGATCTCAGCTCACTGCACACTCCGCTTTCC/TGGTTTCAAGCGATTCTCCTGCCTCAGCCTCCTGAGTAGCTGGGACTACAGTCACACACCACCACGCCCGGCTAATTTTTGTATTTTTAGTAGAGTTGGGGTTTCACCATGTTGGCCAGACTGGTCTCGAACTCCTGACCTTGTGATCCGCCAGCCTCTGCCTCCCAAAGAGCTGGGATTACAGGCGTGAGCCACCGCGCTCGGCCCTTTGCATCAATTTCTACAGCTTGTTTTCTTTGCCTGGACTTTACAAGTCTTACCTTGTTCTGCCTTCAGATATTTGTGTGGTCTCATTCTGGTGTGCCAGTAGCTAAAAATCCATGATTTGCTCTCATCCCACTCCTGTTGTTCATCTCCTCTTATCTGGGGTCACA/CTATCTCTTCGTGATTGCATTCTGATCCCCAGTACTTAGCATGTGCGTAACAACTCTGCCTCTGCTTTCCCAGGCTGTTGATGGGGTGCTGTTCATGCCTCAGAAAAATGCATTGTAAGTTAAATTATTAAAGATTTTAAATATAGGAAAAAAGTAAGCAAACATAAGGAACAAAAAGGAAAGAACATGTATTCTAATCCATTATTTATTATACAATTAAGAAATTTGGAAACTTTAGATTACACTGCTTTTAGAGATGGAGATGTAGTAAGTCTTTTACTCTTTACAAAATACATGTGTTAGCAATTTTGGGAAGAATAGTAACTCACCCGAACAGTGTAATGTGAATATGTCACTTACTAGAGGAAAGAAGGCACTTGAAAAACATCTCTAAACCGTATAAAAACAATTACATCATAATGATGAAAACCCAAGGAATTTTTTTAGAAAACATTACCAGGGCTAATAACAAAGTAGAGCCACATGTCATTTATCTTCCCTTTGTGTCTGTGTGAGAATTCTAGAGTTATATTTGTACATAGCATGGAAAAATGAGAGGCTAGTTTATCAACTAGTTCATTTTTAAAAGTCTAACACATCCTAGGTATAGGTGAACTGTCCTCCTGCCAATGTATTGCACATTTGTGCCCAGATCCAGCATAGGGTATGTTTGCCATTTACAAACGTTTATGTCTTAAGAGAGGAAATATGAAGAGCAAAACAGTGCATGCTGGAGAGAGAAAGCTGATACAAATATAAATGAAACAATAATTGGAAAAATTGAGAAACTACTCATTTTCTAAATTACTCATGTATTTTCCTAGAATTTAAGTCTTTTAATTTTTGATAAATCCCAATGTGAGACAAGATAAGTATTAGTGATGGTATGAGTAATTAATATCTGTTATATAATATTCATTTTCATAGTGGAAGAAATAAAATAAAGGTTGTGATGATTGTTGATTATTTTTTCTAGAGGGGTTGTCAGGGAAAGAAATTGCTTTTTTTCATTCTCTCTTTCCACTAAGAAAGTTCAACTATTAATTTAGGCACATACAATAATTACTCCATTCTAAAATGCCAAAAAGGTAATTTAAGAGACTTAAAACTGAAAAGTTTAAGATAGTCACACTGAACTATATTAAAAAATCCACAGGGTGGTTGGAACTAGGCCTTATATTAAAGAGGCTAAAAATTGCAATAAGACCACAGGCTTTAAATATGGCTTTAAACTGTGAAAGGTGAAACTAGAATGAATAAAATCCTATAAATTTAAATCAAAAGAAAGAAACAAACTA/GAAATTAAAGTTAATATACAAGAATATGGTGGCCTGGATCTAGTGAACATATAGTAAAGATAAAACAGAATATTTCTGAAAAATCCTGGAAAATCTTTTGGGCTAACCTGAAAACAGTATATTTGAAACTATTTTTAAA Three variants are present
These three variants could theoretically occur in 8 different haplotypes …C…A…A… …C…A…G… …C…C…A… …C…C…G… …T…A…A… …T…A…G… …T…C…A… …T…C…G…
But in practice, only two are observed …C…A…A… …C…A…G… …C…C…A… …C…C…G… …T…A…A… …T…A…G… …T…C…A… …T…C…G…
A Haplotype Map of Human Variation • Goal is to define all common haplotypes in the human genome • Genome-wide association studies can then be done with a haplotype tag set of about 250,000 SNPs • Pilot studies underway to determine how many populations to sample, and best strategy for defining haplotype blocks
Current high throughput SNP genotyping methods • DNA chips • Beads/fiberoptics • Fluorescent single base extension • Pyrosequencing • Mass spectrometry • TaqMan • Invader • Etc., etc.
Genotyping costs of all these methods are still prohibitively high (around $0.50/genotype). At least until costs come down, DNA pooling offers a potential strategy to make case control association studies affordable.
Creating DNA Pools Case DNA Samples Control DNA Samples “Case” Pool “Control” Pool F Spouses F Elderly Controls F Index cases F Index cases from “linked” families
Testing performance of methods for determining allele frequency differences in pools • Tested 16 non-optimized SNPs with three different methods • Each assay carried out 8 – 16 times to assess reproducibility • Each method was tested on three pools with n>100 • Diabetics • Spouses • Elderly non-diabetics • True differences between cases and controls (from individual genotypes) ranged from 0 to 12.5%
G A Diabetic Probands 38% A G Spouse Controls 34% A A G Elderly Non-diabetic Controls 30% A A MALDI-TOF Mass Spectrometric Detection of Allele Frequencies in Pooled DNA Samples
Possible future scenario for identifyingsusceptibility alleles for common disease • Collect 1000 cases and 1000 controls • Prepare a pooled DNA sample from cases, and a pooled DNA sample from controls • Using a method that gives precise allele frequencies to within 3% or less, genotype the pools with the ~250,000 haplotype tag SNPs • Confirm any apparent allele differences by doing individual genotypes • Allows genome-wide association studies with only 500,000 genotypes
Fine mapping with SNPs Association identified Causative variant identified
Fulfilling the Promise of Genomics for Better Health Medical Genomics Functional Genomics Proteomics Comparative Genomics
A sample of ongoing public large scale animal genome sequencing projects Mouse – now at 7X Rat – now at 4X Tetraodon – now at 6X Fugu – now at 5X Zebrafish – now at 2X Ciona intestinalis – now at 10X Ciona savignyi – now at 12X C. briggsae – now at 10X
New Genomes Placed on NHGRI High Priority List for Sequencing May 22, 2002 • Chimpanzee • Chicken • Honeybee • Tetrahymena • Several fungi • Sea urchin
The Mouse Genome Sequencing Consortium The Sanger Institute Washington University Whitehead Institute NHGRI Wellcome Trust Ensembl
Average nucleotide resides on a 24.8 kb contig 16.9 Mb supercontig
100% 50% Reference = HUMAN CAV2,1 MET CAPZA2 ST7 WNT2 GASZ CFTR CORTBP2 PipMaker: Human-Mouse Alignment
Ethical, Legal, and Social Implications An integral component of the Human Genome Project
Will effective legislative solutions to genetic discrimination be found?
Can health care providers and the public become genetically literate in time?
Will the benefits of the advances in genetics only be available to a privileged few?
Will knowledge of human variation reduce prejudice, or increase it?
Will we arrive at consensus about the limits of genetic technology for trait enhancement?
Will we succumb to genetic determinism, neglecting the role of the environment, and undervaluing the power of the human spirit and our need for God?
2010 Mainstreaming of individualized preventive medicine -- Predictive genetic tests available for a dozen conditions -- Interventions to reduce risk available for several of these -- Pharmacogenomics is standard of care for several drugs BUT…. -- Will access be inequitable? -- Will reasonably effective legislative solutions to genetic discrimination be in place?
2020 Genomic therapeutic revolution in full swing -- Gene-based designer drugs available for diabetes, Alzheimer’s… -- Gene therapy standard of care for several conditions -- Sequencing a complete human genome costs $1,000 or less BUT…. -- Intense debate underway on non-medical uses of genetics