Fig. S1 (A), Cao, et al. 2013

Jul 23, 2014

20 likes | 125 Vues

Fig. S1 (A), Cao, et al. 2013. cytidine , 243.9 →111.9. 2′-deoxyguanosine, 268.1 →152.0. Fig. S1 (B), Cao, et al. 2013.

Share Presentation

Embed Code

Link

nellis

Télécharger la présentation

Fig. S1 (A), Cao, et al. 2013

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Fig. S1 (A), Cao, et al. 2013
cytidine, 243.9→111.9 2′-deoxyguanosine, 268.1→152.0 Fig. S1 (B), Cao, et al. 2013

Fig. S1

a) GLM without Q matrix. b) GLM with Q matrix. a) MLM without Q matrix ( K -only). b) MLM with Q matrix ( Q + K ). Fig. S1.

144 views • 1 slides

Tholen et al ., Sup . Fig. S1

Tholen et al ., Sup . Fig. S1. Tholen et al ., Sup . Fig. S2. A. B. C. Tholen et al ., Sup . Fig. S3. A. B. No . of proteins identified. No . of proteins identified. C. D. No . of proteins identified. No . of proteins identified. Tholen et al ., Sup . Fig. S4.

139 views • 6 slides

Fig. S1; Ritter et al. 2010

Relative induction of p-Erk1. Relative induction of p-IRAK1. Relative induction of p-RAF. Relative induction of p-Erk2. Relative induction of p-MKK6/3. Relative induction of p-MEK1/2. Fig. S1; Ritter et al. 2010. Relative induction of p-ELK. Relative induction of p-RSK.

188 views • 3 slides

Table S1. List of antibodies

Table S1. List of antibodies. Dupuy et al ., 2013.

127 views • 1 slides

Fig. S1

Fig. S1. A. B. C. D. Fig. S2. A. B. C. D. Fig. S3. E. A. C. D. B.

158 views • 3 slides

Miao et al., Fig. S1

Miao et al., Fig. S1.

160 views • 7 slides

Fig S1

Figure S1: 5T4 expression in B cell development . Adapted from microarray data published online by van Zelm et al http://franklin.et.tudelft.nl/#bcell [11]. Fig S1. (i). (ii). (ii). C. Figure S2 Expression of 5T4 by B-ALL relapse patients blasts

236 views • 7 slides

Supplemental Fig. S1 Awano et al

*. 0.10. D272NRNase R. 0.08. D280NRNase R. D. CsdA-. C. 0.06. Fraction unwound. 0.04. 0.02. 0.00. 0. 5. 10. 15. 20. 25. Time (min). Supplemental Fig. S1 Awano et al. A. CsdA- D C. RNase R-WT. D272NRNase R. D278NRNase R. D280NRNase R. Time (min).

121 views • 2 slides

Fig. S1. Ki et al .,

Amino acid sequences of the variable heavy chain of clec14a-CTLD IgGs. Amino acid sequences of the variable light chain of clec14a-CTLD IgGs. Fig. S1. Ki et al .,.

99 views • 1 slides

Pathiraja, et al. Supp. Fig. S1

Pathiraja, et al. Supp. Fig. S1. TRIM24 expression in TCGA BRCA. A. B. Top 30% vs. Bottom 70%. p-value : 1.32e-07. log2 FC (Invasive carcinoma/normal). p-value : 1.46e-08; Odds ratio : 0.43. p-value : 0.047; odds ratio : 1.40. p-value : 3.8e-04; Odds ratio : 1.98. Paired Samples.

194 views • 6 slides

Figure S1

Liu et al. Figure S1. Cyclin B1. Tubulin. pCMX-Cyclin B1. Mock. Liu et al. Figure S2. A. B. pSuper-cdh1+ pSuper-Cyclin B1. pSuper-CON. pSuper-Cdh1. Cdh1. Cyclin B1. Tubulin. Liu et al. Figure S3. A. B. PBS coverage. No PBS coverage.

122 views • 4 slides

Fig. S1

Si. Mg. Ca. S. Fe. A. B. Fig. S1. Fig. S2. a. 10 m. b. S. Mg. O. Na. Si. 1.0. 2.0. 3.0. 4.0. 5.0. 6.0. 7.0. 8.0. keV. 9.0. Fig. S3. Fig. S4.

155 views • 4 slides

Fig. S1. Weng et al.

Relative ELISA titer (%). Fig. S1. Weng et al. 1b 1a 2a. HCR6 RdRp. H77 RdRp. JFH1RdRp. GST-L245A/I253A. A242C/S244D. A238S/Q248E. J6CF RdRpwt. Protein marker. RMT RdRpwt. Con1 RdRpwt. NN RdRpwt. A242C. S244D.

153 views • 5 slides

Fig. S1. (Zhu et al.)

Day 6 T cells. Donor-1. Donor-2. - + - +. - + - +. Roc-A:. - - + +. - - + +. PMA/iono.:. p-JNK-1 -. p-JNK-2 -. JNK-1 -. Fig. S1. (Zhu et al.).

100 views • 1 slides

Fig. S1 Banno et al

Fig. S1 Banno et al. CA9. 549. cgcgtcccagagccaaactgcctctgggtcgtggatctgcctctgaattcacggcatctg. V. longisporum. 1429. cgcgtcccagagccaaactgcctctgggtcgtggatctgcctctgaattcacggcatctg. V. dahliae. 1773. ------------------------------------------------------------. CA9. 609.

100 views • 2 slides

Fig. S1

Fig. S1. Parvanov et al. HindIII. BamHI. HindIII. HindIII. HindIII. L. K. mat2. mat1. mat3. mat1-M smt . 4.2Kb. 2.1Kb. 4.2 Kb. 10.4 Kb. HindIII. HindIII. HindIII. BamHI. HindIII. BamHI. L. K. mat2. mat1. mat3. mat1-P smt . 4.2Kb. 4.2 Kb. 2.1Kb. 4.6Kb. 5.8Kb.

114 views • 1 slides

Fig. S1

Fig. S1. Fig. S2. M SR_1 SR_2 SR_3 SR_1 SR_2 SR_3 SR_1 SR_2 SR_3. SSR 1. SSR 3. SSR 2. Polymorphism of the primers (SSR1-3) in 3 Stevia genetypes. Fig. S3. A. B. C. Fig. S 4. A. B. C. Fig. S 5. A. B. Ｃ. A. Fig. S 6. B. C. Fig. S 7. A. B.

249 views • 7 slides

Fig. S1 . Lee. et. al.

132 views • 1 slides

Fig. S1 . Okubo et al.

a. b. c. d. e. g. f. h. i. k. j. l. Fig. S1 . Okubo et al. a. c. b. d. e. g. f. h. i. j. k. l. Fig. S2 . Okubo et al. a. c. b. d. e. g. f. h. i. j. k. l. Fig. S3 . Okubo et al. a. d. b. c. g. h. e. f. k. i. j. l. Fig. S4 . Okubo et al. a. c. d.

147 views • 6 slides

Supplemental Fig. S1. Nishimura et al. PMB

Supplemental Fig. S1. Nishimura et al. PMB. A. RlemMT1. B. RlemMT2.

100 views • 1 slides

Teng et al. Fig. S1

Teng et al. Fig. S1. D ssa1. D dnm1. D ssa2. D ssa1. D dnm1. D ssa2.

96 views • 1 slides

(A)

(A). PR1. PAP5. Figure S3. Ravichandran et al. 2013.

127 views • 1 slides

More Related