nessa
Uploaded by
56 SLIDES
770 VUES
560LIKES

Information Storage and Processing in Biological Systems:

DESCRIPTION

Information Storage and Processing in Biological Systems: A seminar course for the Natural Sciences. Sept 16 Introduction / DNA, Gene regulation Sept 18 Translation and Proteins Sept 23 Enzymes and Signal transduction Sept 25 Biochemical Networks Sept 30 Simple Genetic Networks

1 / 56

Télécharger la présentation

Information Storage and Processing in Biological Systems:

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Information Storage and Processing in Biological Systems: A seminar course for the Natural Sciences Sept 16 Introduction / DNA, Gene regulation Sept 18 Translation and Proteins Sept 23 Enzymes and Signal transduction Sept 25 Biochemical Networks Sept 30 Simple Genetic Networks Oct 2 Adventures in Multicellularity Nov 6 Evolution, Evolvability and Robustness

  2. Reading List for Part 1 Chapters 1-3 “The Thread of Life” S. Aldridge Cambridge University Press. 1996. “Genes & Signals” by Mark Ptashne and Alexander Gann. (2002) CSHL Press. -------------------------------------------------------------------------------------------- From molecular to modular cell biology. (1999) L. H. Hartwell, J. J. Hopfield, S. Leibler and A. W. Murray. Nature 402 (SUPP): C47-C52. It’s a noisy business! Genetic regulation at the nanomolar scale. H. Harley and A Arkin. Trends In Genetics February 1999, volume 15, No. 2 The challenges of in silico biology. (2000) B. Palsson. Nature Biotechnology 18: 1147-1150.

  3. What is “biological information” and how is it “Stored” and Processed”? M.C. Escher Spirals

  4. What is “biological information”? Genetic(DNA and RNA)

  5. What is “biological information”? Genetic(DNA and RNA) Epigenetic(DNA modification)

  6. What is “biological information”? Genetic(DNA and RNA) Epigenetic(DNA modification) Non-Genetic Inheritance(template dependent replication) paragenetic

  7. Global patterning of organelles and cilia in Paramecium relies on paragenetic information and is template dependent. Another example is Mad Cow Disease

  8. What is “biological information”? Genetic(DNA and RNA) Epigenetic(DNA modification) Non-Genetic Inheritance(template dependent replication) Physiological-Cellular Level (Structural/Metabolism/Signal Transduction)

  9. Simplified Connectivity of Map of Metabolism Each node represents a chemical in the cell (E. coli) Each connection represents an enzymatic step or steps

  10. What is “biological information”? Genetic(DNA and RNA) Epigenetic(DNA modification) Non-Genetic Inheritance(template dependent replication) Physiological-Cellular Level (Structural/Metabolism/Signal Transduction) Physiological- Organism Level (Structural/Metabolism/Signal Transduction, Development, Immune System)

  11. What is “biological information”? Genetic(DNA and RNA) Epigenetic(DNA modification) Non-Genetic Inheritance(template dependent replication) Physiological-Cellular Level (Structural/Metabolism/Signal Transduction) Physiological- Organism Level (Structural/Metabolism/Signal Transduction, Development, Immune System) Populations (Population dynamics, Evolution)

  12. What is “biological information”? Genetic(DNA and RNA) Epigenetic(DNA modification) Non-Genetic Inheritance(template dependent replication) Physiological-Cellular Level (Structural/Metabolism/Signal Transduction) Physiological- Organism Level (Structural/Metabolism/Signal Transduction, Development, Immune System) Populations (Population dynamics, Evolution) Ecosystem(Interacting Populations, environment  populations )

  13. DNA transcription mRNA translation Protein The“Central Dogma” The central dogma relates to the flow of ‘genetic’ information in biological systems. DNARNAProtein

  14. Overview of Biological Systems Organization of the Tree of Life Three evolutionary branches of life: Eubacteria, Archaebacteria, Eukaryotes The macroscopic world represents a small portion of the tree.

  15. The Eubacteria (bacteria), Archaebacteria (archae), and Eukaryotes represent three fundamental branches of life and represent two fundamental differences in organization of the cell. Major Similarities: Genetic code Basic machinery for interpreting the code Major Differences: Organization of genes Organization of the cell sub-cellular organelles in Eukaryotes * cytoskeletal structure in Eukaryotes ** No true multicellular organization in bacteria and archae (there are many single celled eukaryotes). (debatable) * compartmentalization of function ** morphologically distinct cell structure

  16. Bacteria Morphologically “simple” - shape defined by cell surface structure. Transcription (reading the genetic message) and Translation (converting the genetic message into protein) are coupled- they take place within the same compartment (cytoplasm).

  17. Compartmentalization of Function in eukaryotic cells Transcription (reading the genetic message) and Translation (converting the genetic message into protein) occur in different compartments in the eukaryotic cell.

  18. Example of single celled eukaryotic organisms Morphological diversity (cytoskeleton as well as cell surface structures)

  19. There are many distinct morphological cell types within a multicellular organism. Morphological diversity arises from cytoskeletal networks - architectural proteins

  20. Some ‘Model’ Experimental Eukaryotic Organisms Caenorhabditis elegans (round worm) Saccharomyces cerevisiae Drosophila melanogaster (fruit fly) mouse Antirrhinum majus (snapdragons ) Zebrafish Arabidopsis thaliana

  21. Bacteriophage (Phage) and Viruses 1) genetic material / nucleic acid 2) protective coat protein The information for their own replication and the means to “target” the correct cell/host but no interpretive machinery

  22. Genotype The genetic constitution of an organism. Phenotype The appearance or other characteristic of an organism resulting from the interaction of its genetic constitution with the environment.

  23. Constraints in Biological Systems • Chemical/Physical constraints • stability of biological material • reaction rates and diffusion rates • - properties of biochemical reactions (enzymes) differ from chemical reactions • time dependency of many steps - time scales over many orders of magnitude for different steps • -receptor ligand binding msec • -biochemical response sec • -genetic response minutes- hours-days • statistical properties of ‘small-scale” chemistry, i.e. where concentration of reacting molecules is low. • Evolutionary constraints • a biological system is constrained by it’s own evolutionary history (and also ‘biological’ history)

  24. “Alarm clock” from the movie Brazil Evolution of new functions is rarely de novo invention but is typically due to the modification of pre-existing functions/structures.

  25. Modularity • Is the cell/organism designed in a modular fashion? • Can we approximate cell behavior into modules? • Can interactions of cells, individuals, organisms be treated in a similar way? • Coarse graining • At what level of detail do we need to study/model a system to extract information about the underlying mechanisms? • What level of detail is required to define the “state” of the cell, the individual, the population and ecosystem…? • Can we define the “state” of the cell or only “states” of modules?

  26. Stochastic variations and Individuality • What is the source of stochastic variation (independent of genetic variation)? • In genetically identical populations, does this play a role in adaptation? • What role do stochastic processes play in development? • Robustness • Despite stochastic variations, many cellular processes are extremely robust (genetic networks, biochemical networks, cell divisions, development,…) • How does the cell overcome the limitations imposed by stochastic variations? • Where does robustness arise? Is it a network property?

  27. Redundancy • - Many biological processes are duplicated so that the same function is present in multiple elements. Mutations (changes in genotype) may have no apparent phenotype or one that is less severe than expected. • - Many biological systems are degenerate, they can occur by alternative pathways. • Complexity • “the whole is greater than the sum of its parts.”

  28. Genotype  Phenotype Can we understand the mechanisms and processes that shape the expression of genetic variation in phenotypes?

  29. The Natural History of Dictyostelium discoideum Adventures in Multicellularity The social amoeba (a.k.a. slime molds)

  30. The Natural History of Dictyostelium discoideum Adventures in Multicellularity The social amoeba (a.k.a. slime molds)

  31. The Natural History of Dictyostelium discoideum Adventures in Multicellularity The social amoeba (a.k.a. slime molds)

  32. DNA Basics Four bases A - adenine T - thymine C - cytosine G - guanine anti- parallel double stranded structure with specific bonding between the two strands: A  T base pairing C  G base pairing

  33. DNA Structure • DNA is composed of two strands • Each strand is composed of a sugar phosphate backbone with one of four bases attached to each sugar • The arrangement of bases along a strand is aperiodic • The two strands are arranged anti-parallel • There is base specific pairing between the strands such that A pairs with T and C with G, consequently knowing the sequence of one strand gives us the sequence of the opposite strand. A -T C -G G -C A -T T -A G -C G -C G -C T-A

  34. Chemical Structure of DNA The Double Helix

  35. A -T C -G G -C A -T T -A G -C G -C G -C T-A A C G A T G G G T-A • DNA Replication • Template copying • Semi-conservative A -T C -G G -C A -T T -A G -C G -C G -C T-A A -T C -G G -C A -T T -A G -C G -C G -C T-A A -T G C T A C C C A

  36. The Genetic Code – Triplet Code - directional (always read 5’ 3’) - each triplet of bases codes one amino acid (Codon) - degenerate (many AA have more than one codon)

  37. For a given sequence there are three possible reading frames DNA contains information about the start and end of the gene as well as when to make or if to make transcribe the information.

  38. DNA as an information molecule • DNA sequence itself • DNA sequence as a code of protein • (sequence/properties of the protein) • DNA sequence as controlling elements and recognition sites for cellular machinery • DNA secondary structure and chemical modifications (e.g. methylation) • genetic networks from multiple controlling elements and recognition sites with multiple genes and feedback and or feedforward systems

  39. 5001 CATAAACCGG GGTTAATTTA AATACTGGAA CCGCTTACCA ATAAGACTAA GTATTTGGCC CCAATTAAAT TTATGACCTT GGCGAATGGT TATTCTGATT -2 end of luxS ***I ? gene start +1 MetGlnPhe LeuGlnPhe PhePheArgGln ArgGlnLeu PheIleAla 5051 ATATGCAATT CCTGCAGTTT TTCTTTCGGC AGCGCCAGCT CTTTATTGCT TATACGTTAA GGACGTCAAA AAGAAAGCCG TCGCGGTCGA GAAATAACGA -2 leHisLeuGlu GlnLeuLys GluLysProLeu AlaLeuGlu LysAsnSer +1 hrProAspArg ArgArgLeu HisProGlyMet IleAspCys GluAlaIle 5501 CCCCGGACCG CCGGCGCTTG CATCCGGGTA TGATCGACTG CGAAGCTATC GGGGCCTGGC GGCCGCGAAC GTAGGCCCAT ACTAGCTGAC GCTTCGATAG -2 lyArgValAla ProAlaGln MetArgThrHis AspValAla PheSerAsp +1 ***end of ? gene 5551 TAATAATGGC ATTTAGTCAC CTCCGATAAT TTTTTAAAAA TAAACTGAAC ATTATTACCGTAAATCAGTG GAGGCTATTA AAAAATTTTT ATTTGACTTG -2 LeuLeuProMet luxS start

  40. Two ways of thinking about “information” in DNA 1) DNA has sequence information which is TRANSCRIBED into RNA (i.e. it is a template) and TRANSLATED from RNA into protein (Genetic Code). 5’---CTCAGCGTTACCAT---3’ 3’---GAGTCGCAATGGTA---5’ 5’---CUCAGCGUUACCAU---3’ N---Leu-Ser-Val-Thr---C DNA RNA PROTEIN Transcription Translation • In RNA T’s are replaced by U’s • Some gene products are RNA, i.e. they are not translated (e.g. tRNA, rRNA)

  41. Two ways of thinking about “information” in DNA 2) DNA has sequence information at a structural level. This form of information directs the ‘interpretative machinery’ in the cell (protein complexes), in most instances binding sites for proteins. This type of ‘information’ is important for example in determining where(along a sequence of DNA) and whena gene may be turned on, initiation of DNA replication, packaging of DNA etc… i.e - Regulation

  42. The Basic Transcription Components (Bacterial) Transcription Machinery s factor a2bb’holoenzyme RNA Polymerase start DNA -35 -10 Promoter - binding site for RNA polymerase, defines where the process will begin.

  43. Promoter Binding -35 -10 Open Complex Formation Promoter Clearance Messenger RNA (mRNA)

  44. Regulation of Gene Expression: The Basics Transcriptional Regulators are proteins that act to modulate gene expression. Proteins that negatively regulate expression (i.e decrease transcription) are called Repressors and those that act positively (i.e. increase transcription of a gene) are called Activators. These proteins act by binding at specific DNA sites are modulate RNA polymerase function. These binding sites are called operators. start -35 -10 promoter operator

  45. Repressor X start -35 -10 Repression can be viewed as a competition for binding between the polymerase and the repressor (an oversimplification).

  46. Activator start -35 -10 promoter operator An Activator promotes RNA polymerase biding activity through direct protein-protein interactions (an oversimplification).

  47. Any DNA binding protein, with an appropriately placed binding site can act as a repressor. Activation requires specific protein-protein interaction between the activator and RNA polymerase. • Typically bacterial promoters are regulated by a few proteins at most and the control regions tend to be quite small. • Eukaryotic gene regulatory regions can be very large and involve many transcriptional regulators. • Activation and repression depend on positioning of operator sites. • Multiple inputs can be integrated at the level of gene expression.

  48. Consensus Binding Sites The interaction of a DNA-Binding Protein (such as RNA Polymerase or transcriptional regulators) is dependent on the ‘affinity’ of the protein for the binding site. This affinity will vary under different physiological conditions, as the concentration of the protein changes and also will depend on the binding site itself. The optimal binding site is usually close to the consensus sequence for that site obtain by aligning all the know binding sites. On can thus have a range of ‘activity’ at different promoters/operators by having differences in DNA binding sites. E. coli Promoters -35 box-10 box ConsensusTTGACA- N17- TATAAT Examples:TTGATA- N16- TATAAT TTCCAA- N17- TATACT TGTACA- N19- CATAAT TTGATC- N17- TACTAT TTGACA- N17- TAGCTT

  49. “Activity” of Transcriptional Regulators in Response to ‘Signals’ Case 1. Affinity of the protein for DNA may be modified by binding a ‘ligand’ (Allosteric mechanism). Case 2. Affinity of the protein may be affected by covalent modification such as phosphorylation. DNA R R-DNA x DNA Rx Rx-DNA DNA Both of these mechanisms (ligand binding and post-translational modification) are common themes in the regulation of proteins, not just in transcription control.

  50. Regulation of Gene Expression DNA RNA polymerase binding Open Complex Formation Transcription mRNA mRNA stability Translation Protein Polypeptide folding Protein stability Both positive and negative regulation can occur at any step in this process.

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer