1 / 16

GFP – LacZ alpha fusion presentation

GFP – LacZ alpha fusion presentation. Overview of work done Questions I plan to answer [1] Scope of work [1] [1] Based upon discussion with Austin Che. GFP – LacZ alpha fusion presentation. Overview of work done Questions I plan to answer [1] Scope of work [1]

nigel
Télécharger la présentation

GFP – LacZ alpha fusion presentation

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. GFP – LacZ alpha fusion presentation • Overview of work done • Questions I plan to answer [1] • Scope of work [1] • [1] Based upon discussion with Austin Che

  2. GFP – LacZ alpha fusion presentation • Overview of work done • Questions I plan to answer [1] • Scope of work [1] • [1] Based upon discussion with Austin Che

  3. Big picture : want dual reporter GFP ß-galactosidase (ß-gal) [1] Dual reporter genes enabling cell tracing with viable and reliable selection of various cell types C.N. Hwang, S. Hong, S.S. Choi, K.S. Lee, S.S. Park & S.H. Lee Biotechnology Letters. 2006.

  4. 1. Hwang et al GFP – full length LacZ fusion : Works Hwang et al (2006) C-terminal GFP (red) 11 AA linker LacZ monomer 1 (Brown) N-terminal LacZ (yellow) LacZ monomer 2 (Purple) LacZ sub-units (purple and brown) : N-tern (yellow): missing three residues (MTM) C-term (red): none missing GFP : N-term: missing two residues (MR) C-term : missing eight residues (HGMDELYK)

  5. 2. Austin Che GFP and N-terminal LacZ alpha fusion : Doesn’t work Bba_E0050 C-terminal GFP (red) No linker LacZ alpha (blue) N-terminal LacZ (yellow) LacZ – alpha fragment (blue) : N-tern (yellow): missing three residues (MTM) C-term (red): none missing GFP : N-term: missing two residues (MR) C-term : missing eight residues (HGMDELYK)

  6. 3. Austin Che LacZ-alpha and N-terminal GFP fusion : Works Bba_E0051 N-terminal GFP (yellow) 18 AA linker C-terminal LacZ (red) LacZ – alpha fragment (blue) : N-tern (yellow): missing three residues (MTM) C-term (red): none missing GFP : N-term: missing two residues (MR) C-term : missing eight residues (HGMDELYK)

  7. 4. Austin Che LacZ-alpha and N-terminal GFP variants Bba_E0051 Have this with 12 promoter / RBS combinations LacZ – alpha fragment (blue) : N-tern (yellow): missing three residues (MTM) C-term (red): none missing GFP : N-term: missing two residues (MR) C-term : missing eight residues (HGMDELYK)

  8. GFP – LacZ alpha fusion presentation • Overview of work done • Questions I plan to answer [1] • Scope of work [1] • [1] Based upon discussion with Austin Che

  9. Questions • 1. Can E0051 be used to report promoter activity? • Scope of work • Receive E0051 from Austin • PCR with BBa sites on primers and with RBS on forward primer • Insert into flipee vector, downstream of promoter

  10. Questions • 2. Does re-designed E0050 fusion work? • Scope of work • Receive E0051 primer designs from Austin • Design primers for PCR of LacZ and GFP, with linker / RBS • PCR “stitch” to create E0050 with linker Bba_E0050 Insert linker

  11. Questions • 3. How d0 E0050 2.0, E0051, E0050, and full length fusion compare? • Scope of my work based upon discussions with Austin • Receive full length GFP fusion from Hwang group and E0050. • Compare performance of constructs.

  12. Questions • 4. Are GFP/lacZ activities correlated independent of promoter/RBS? • Scope of my work based upon discussions with Austin • Evaluate on microplate reader.

  13. Questions • Can E0051 be used to report promoter activity? • Does re-designed E0050 fusion work? • How d0 E0050 2.0, E0051, E0050, and full length fusion compare? • Are GFP/lacZ activities correlated independent of promoter/RBS? • Scope of work • Receive E0051, E0051, 12 E0051 variants, primer designs from Austin • Receive full length GFP fusion from Hwang group • PCR E0051 w/ BBa sites on primers and with RBS on forward primer • Insert into flipee vector, downstream of promoter, test • Design primers for PCR of LacZ and GFP, with linker / RBS • PCR “stitch” to create an E0050 with linker • Compare performance of E0050 2.0, E0051, E0050, Hwang fusion. • Evaluate promoter/RBS variants on microplate reader.

  14. Appendix I: Hwang et al

  15. 1. LacZ – GFP fusion : Hwang et al [1] show fusion protein between GFP and the N-terminal alpha fragment of full length lacZ + LacZ excised from pMC1817 by Pst1 MCS Pst1 LacZ GFP 11 amino acid linker EcoR1 TCCGGACTCAGATCTCGAGCTCAAGCTTCGAATTCTGCAG [1] Dual reporter genes enabling cell tracing with viable and reliable selection of various cell types C.N. Hwang, S. Hong, S.S. Choi, K.S. Lee, S.S. Park & S.H. Lee Biotechnology Letters. 2006.

  16. 1. LacZ – GFP fusion : It works [1] GFP ß-galactosidase (ß-gal) [1] Dual reporter genes enabling cell tracing with viable and reliable selection of various cell types C.N. Hwang, S. Hong, S.S. Choi, K.S. Lee, S.S. Park & S.H. Lee Biotechnology Letters. 2006.

More Related