1 / 6

T-DNA mapping by PCR

ABE workshop 2007. T-DNA mapping by PCR . Eun Ju Cho. Objectives.

oihane
Télécharger la présentation

T-DNA mapping by PCR

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. ABE workshop 2007 T-DNA mapping by PCR Eun Ju Cho

  2. Objectives To more fully understand the function of PDIs in plants, we are using a method called “gene knockouts”, which allows the determination of the resulting effects of the absence of a specific gene on growth, development, cell physiology and biochemistry. The gene is knocked out by disruption with a DNA insertion that contains a kanamycin resistance gene (kanR), called a “T-DNA”.

  3. What is the T-DNA? “Transfer”-DNA (T-DNA) can be randomly inserted into the plant genome by Agrobacterium tumefaciens. The T-DNA contains a selectable marker (kanamycin resistance) and other genes for growth of the Agrobacterium. The insertion of T-DNA into a gene disrupts the gene (“knockout”) and the function of the protein it encodes.

  4. Genetic Map of T-DNA knockout mutant of PDI2 ~200bp LB1 T-DNA ~300bp UTR Exon 1 E2 UTR RP LP ATG 890bp Chromosome 1 At1g52260(PDI 3) LP - Left genomic primer (CCAAAATTAAAAACCAAAAAGCAA) RP - Right genomic primer (TCAAGAAATCTCGGAGCTTCA) LB1 - Left border primer of the T-DNA insertion: ( GCCTTTTCAGAAATGGATAAATAGCCTTGCTTCC)

  5. T-DNA sequence of PDI3 SAIL_302_G10(1071bp) aaatcgaattaattcggcgtaattacgacattaaaaacgtccgcaaggtgttatataagt tgtctaagcgtcaatttgtgataggaattcgaagattgcatcggagcttgagatataaag gtttccctacgcttcttctctactgctcctacacaannnnnnggagccannntccgacgg acggaacagaggcaccagaggccaacacactgaaaagatcattggctgaatacacaaccg aaggtgaagagagagccacaaggaaaacacaaaaacccccaggactaagcgcccgctcaa tccactccaaaaaacacgaccgaataaagcgcactgataaaacacactgaacaacccaaa accacgaagttgcatcatcgaacggctggcagagaaaaagaaccattagacaaacaacgc gcggacatggaacccagacacatacccaacgagaacgcatacgcctacaaatcgcggggt cccaacaaaaaacagcacccgcgccccacaccacacaccgcagtgaagagaacaacacga aacaagaaaaccccgaagagagcgccccccaccccgcacgtgaggaccagccgagacgaa ccagggcggggcacagagagaacacaagggggaacgagagggggcacgcacagagcagga gccaaacgggccagcccaaccccaccaccgcccccacacaacgacgcccaccccacccga cgacccacccccaccgcgcccaacccaccgcaaccccaccccccccgccacccccactcc ccgcggcgcccaccaccacgccccacgcccacacgccaccgcacgacccaanaacacccc gcccgccccacccgccacgaaccgcacccaccgcgccccccaccaccaccccccgccccc cccgccgacgcccgccaccaccacacacgcaccccccaaacccccccaccaccaccccac gcccgcgcgcacccccccccnncccanaacccgccgccccccccccccaacacccgcccc cgccacccccgcgcccgcccgccgcnaccccccacccccaccccaccaccn

  6. PCR mapping for T-DNA knockout mutant of PDI 3 M HM HZ WT T- DNA Primer design LP + RP + LB1 WT : no insertion (890bp) HM : insertion both chromosome (~500bp) HZ : one of the pair chromosome with insertion 1kbp 517bp Condition 94℃ 5min 94 ℃ 30sec 55 ℃ 30sec 30 cycle 72 ℃ 1min 72 ℃ 10min

More Related