1 / 1

Integration Sites of Mobile Element to tRNA-Pro Gene

Putative integration sites for the lvh-containing mobile element. Sequence of tRNA-Pro gene aligned with 77 bp DNA fragments flanking the lvh locus using CLUSTAL_W. Identical residues marked below the alignment by "*". The 45 bp of the 3' end of tRNA-Pro gene identical to both repeats enclosed within a rectangle.

pakuna
Télécharger la présentation

Integration Sites of Mobile Element to tRNA-Pro Gene

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. tRNA-Pro 1267202 CGGGGCGTAGCGCAGCCTGGTAGCGTACTAGCATGGGGTGCTAGTGGTCGAAGGTTCAAATCCTTCCGTCCCGACCA 1267126 repeat-1 1222166 TTTGAAATTGAATGAAATGGGTTGTTATTAGCATGGGGTGCTAGTGGTCGAAGGTTCAAATCCTTCCGTCCCGACCA 1222090 repeat-2 1185492 AAGTTAATACTTTAAATATTGATAGCAAGAGGATGGGGTGCTAGTGGTCGAAGGTTCAAATCCTTCCGTCCCGACCA 1185416 * * ** ********************************************* Figure S3. Putative integration sites for the lvh–containing mobile element Sequence of the tRNA-Pro gene is aligned with the sequences of the 77 bp DNA fragments that flank the lvh locus using CLUSTAL_W. Identical residues are marked below the alignment by “*.” The 45 bp of the 3’ end of the tRNAPro gene that are 100% identical to both repeats are enclosed within a rectangle.

More Related