1 / 24

Understanding Gene Expression Control: Insights from Ecclesiastes and Bacterial Operons

This text explores the interplay between divine timing as noted in Ecclesiastes 3:1,17 and the molecular control of gene expression in bacteria. It discusses how certain genes, like those in the lac and trp operons of E. coli, are expressed only when needed, analogous to the seasons for different purposes in life. The roles of constitutive and inducible genes, as well as the mechanisms governing operon functionality, are examined, highlighting the balance between necessity and wastefulness in cellular processes.

paulos
Télécharger la présentation

Understanding Gene Expression Control: Insights from Ecclesiastes and Bacterial Operons

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Ecclesiastes 3:1, 17 1 To every thing there is a season, and a time to every purpose under the heaven: 17 I said in mine heart, God shall judge the righteous and the wicked: for there is a time there for every purpose and for every work.

  2. Controlling Gene Expression:Bacteria Timothy G. Standish, Ph. D.

  3. All Genes Can’t be Expressed At The Same Time • Some genes are needed for the function of all cells all the time. These continually expressed genes are called constitutive genes. • Other genes are only needed by certain cells or at specific times. The expression of these inducible genes is tightly controlled. • For example, pancreas beta cells make the protein insulin by expressing the insulin gene. Neurons, in comparison, don’t express insulin.

  4. Operons Are Groups Of Genes Expressed By Prokaryotes • The genes grouped in an operon are all needed to complete a given task • Each operon is controlled by a single control sequence in the DNA • Because the genes are grouped together, they can be transcribed together then translated together

  5. The Lac Operon • Genes in the lac operon allow E. coli bacteria to metabolize lactose • E. coli is unlikely to encounter lactose, so it would be wasteful to produce the proteins needed to metabolize it unless necessary • Metabolizing lactose for energy only makes sense when two criteria are met: • Other more readily metabolized sugar (glucose) is unavailable • Lactose is available

  6. The Lac Operon - Parts • The lac operon is made up of a control region and four genes: • LacZ -b-galactosidase - Enzyme that hydrolyzes the bond between galactose and glucose • LacY - Codes for a permease that lets lactose across the cell membrane • LacA - Transacetylase - An enzyme whose function in lactose metabolism is uncertain • Repressor - A protein that works with the control region to control expression of the operon

  7. The Lac Operon - Control • The control region is made up of two parts: • Promoter • Promoters are specific DNA sequences to which RNA Polymerase binds so that transcription can occur • The lac operon promoter also has a binding site for a protein called Catabolite Activator Protein (CAP) • Operator • The binding site of the repressor protein • The operator is located downstream (in the 3’ direction) from the promoter so that if repressor is bound RNA Polymerase can’t transcribe

  8. Hey man, I’m constitutive Repressor Promoter LacZ LacY LacA CAP Binding Repressor Repressor Repressor mRNA Operator CAP The Lac Operon:When Glucose Is Present But Not Lactose Come on, let me through RNA Pol. No way Jose!

  9. Hey man, I’m constitutive RNA Pol. Repressor Promoter LacZ LacY LacA X CAP Binding Repressor Repressor Repressor mRNA Repressor Operator CAP The Lac Operon:When Glucose And Lactose Are Present Great, I can transcribe! RNA Pol. Lac This lactose has bent me out of shape Some transcription occurs, but at a slow rate

  10. Hey man, I’m constitutive RNA Pol. Repressor Promoter LacZ LacY LacA X CAP CAP CAP Binding Repressor Repressor Repressor mRNA cAMP cAMP cAMP Repressor Operator CAP The Lac Operon:When Lactose Is Present But Not Glucose Bind to me Polymerase Yipee…! RNA Pol. Lac This lactose has bent me out of shape

  11. Alright, I’m off to the races . . . Hey man, I’m constitutive Repressor Promoter LacZ LacY LacA CAP CAP CAP Binding Repressor Repressor Repressor mRNA cAMP cAMP cAMP Operator CAP The Lac Operon:When Neither Lactose Nor Glucose Is Present Bind to me Polymerase Come on, let me through! RNA Pol. STOP Right there Polymerase

  12. The Trp Operon • Genes in the trp operon allow E. coli bacteria to make the amino acid tryptophan • Trp operon genes encode enzymes involved in the biochemical pathway that converts the precursor chorismate to tryptophan. • The trp operon is controlled in two ways: • Using a repressor that works in exactly the opposite way from the lac operon repressor • Using a special attenuator sequence

  13. 5-Phosphoribosyl- a-Pyrophosphate Glutamine Glutamate + Pyruvate PPi COO- COO- NH2 -OOC Anthranilate synthetase CH2 O C COO- Anthranilate synthetase (trpE and D) HN N-(5’- Phosphoribosyl) -anthranilate O CH2 -2O3P Chorismate H Anthranilate O H H HO N-(5’-Phosphoribosyl)-anthranilate isomerase Indole-3’-glycerol phosphate synthetase (trpC) H H H OH OH OH OH OH OH CO2+H2O -2O3PO CH2 -OOC C C C -2O3PO CH2 C C C OH N-(5’-Phosphoribosyl)- Anthranilate isomerase Indole- 3’-glycerol phosphate synthetase H H Enol-1-o- Carboxyphenylamino -1-deoxyribulose phosphate C H H H C H H N H N H Tryptophan synthetase (trpB and A) Indole-3-glycerol phosphate -OOC C CH2 Glyceraldehyde- 3-phosphate NH3+ Serine H2O N H N H Tryptophan synthetase Indole Tryptophan The TryptophanBiochemical Pathway

  14. Hey man, I’m constitutive Repressor Promo. Lead. Aten. trpE trpD trpC trpB trpA Repressor Repressor mRNA Operator Trp Trp Repressor The Trp Operon:When Tryptophan Is Present Foiled Again! RNA Pol. STOP Right there Polymerase

  15. Hey man, I’m constitutive RNA Pol. Repressor Promo. Lead. Aten. trpE trpD trpC trpB trpA Repressor mRNA Operator Repressor The Trp Operon:When Tryptophan Is Absent RNA Pol. Repressor needs his little buddy tryptophan if I’m to be stopped I need tryptophan

  16. Attenuation • The trp operon is controlled both by a repressor and attenuation • Attenuation is a mechanism that works only because of the way transcription and translation are coupled in prokaryotes • Therefore, to understand attenuation, it is first necessary to understand transcription and translation in prokaryotes

  17. 5’ 3’ 3’ 5’ RNA Pol. Ribosome mRNA Ribosome 5’ Transcription And Translation In Prokaryotes

  18. 1 2 3 4 The Trp Leader and Attenuator Met-Lys-Ala-Ile-Phe-Val- AAGUUCACGUAAAAAGGGUAUCGACA-AUG-AAA-GCA-AUU-UUC-GUA- Leu-Lys-Gly-Trp-Trp-Arg-Thr-Ser-STOP CUG-AAA-GGU-UGG-UGG-CGC-ACU-UCC-UGA-AACGGGCAGUGUAUU CACCAUGCGUAAAGCAAUCAGAUACCCAGCCCGCCUAAUGAGCGGGCUUUU Met-Gln-Thr-Gln-Lys-Pro UUUU-GAACAAAAUUAGAGAAUAACA-AUG-CAA-ACA-CAA-AAA-CCG trpE . . . Terminator

  19. 1 2 1 2 3 3 4 4 The mRNA Sequence Can Fold In Two Ways Terminator hairpin

  20. 5’ 3’ Leader peptide 3’ 5’ 2 3 Ribosome 4 1 The Attenuator When Starved For Tryptophan RNA Pol. Help, I need Tryptophan Ribosome stalls over sequence 1 and sequence 2 binds to sequence 3 preventing formation of the 3, 4 hairpin

  21. 5’ 3’ 3’ 5’ Ribosome 1 2 3 4 Leader peptide is released The Attenuator When Tryptophan Is Present RNA Pol. Ribosome passes over sequence 1 and onto sequence 2 allowing sequence 3 to form the 3, 4 hairpin

  22. 5’ 3’ 3’ 5’ Ribosome 1 2 3 4 The Attenuator When Tryptophan Is Present RNA Pol. The 3, 4 hairpin destabilizes the elongation complex

  23. 5’ 3’ 3’ 5’ Ribosome RNA polymerase falls off ending transcription 1 2 3 RNA Pol. 4 The Attenuator When Tryptophan Is Present

  24. The End

More Related