penn
Uploaded by
29 SLIDES
532 VUES
320LIKES

Genotypic Microbiological Methods

DESCRIPTION

Genotypic Microbiological Methods. Can be used to determine genetic composition of organisms: Identify organisms (diagnostics) Identify distinct groups of organisms (taxonomy/systematics) by examining similarity between organisms Examine temporal or spatial variation of populations

1 / 29

Télécharger la présentation

Genotypic Microbiological Methods

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Genotypic Microbiological Methods Can be used to determine genetic composition of organisms: Identify organisms (diagnostics) Identify distinct groups of organisms (taxonomy/systematics) by examining similarity between organisms Examine temporal or spatial variation of populations Study genes function and regulation Assess viability of cells

  2. Overview of Molecular (DNA) Methods • Restriction Enzyme Digestion • RFLP • PFGE DNA “fingerprinting” Combination of methods e.g. ribotyping • Labeled Probes • PCR based methods • DNA sequencing • DNA microarrays

  3. DNA isolation • Grow cells to stationary phase (for maximum yield) • Lyse cells with heat, enzyme, or detergent • Digest proteins with proteinase K enzyme • Separate DNA from other molecules by solubility, charge, size etc..( methods vary) Commercially available methods Use centrifuge to pass cell lysate through filter, DNA binds to filter Add solvent to filter and centrifuge DNA out into clean tube

  4. Gel Electrophoresis DNA samples added to wells in matrix - Gel made of translucent, porous matrix + DNA migrates at a rate inversely related to log10 of amplicon size

  5. Gel electrophoresis EtBr binds to DNA as it travels through the gel EtBr fluoresces under UV light When viewed in the dark UV light, the DNA appears as bright bands Larger fragments of DNA remain near the top and smaller ones migrate to the bottom

  6. Hybridization and Annealing of Nucleic Acids Complimentary sequences of ssDNA will bind together to form dsDNA Temperature at which dsDNA remains together depends on percent of matching and GC content Does not yield the DNA sequence of organisms, just the sequence similarity between organisms Total genomic hybridization can be used to estimate overall genetic similarity between organisms Oligonucleotide primers and probes can be designed to detect and ID genes

  7. Labeled Probes Oligonucleotide-short piece of DNA Complementary-has corresponding nucleotide base sequence (ATCG- TAGC) Target- specific region of organism’s DNA to be probed Labels- a molecule that is attached to the probe and can be observed by some direct (fluorescent) or indirect means (immunodetection) TATGCATT TAACGCCGAGGTATGCATTGCATGCCTGACTGAATCGA ….ATTGCGGCTCCATACGTAACGTACGGACTGACTTAGCT……..

  8. RFLP RFLP-restriction fragment length polymorphisms Organism B Organism A DNA RE cuts wherever it recognizes specific site _ + Gel electrophoresis

  9. Separation and visualization DNA fragments _ Large pieces of DNA L 1 2 3 4 5 6 7 8 9 10 11 12 13 14 L Small pieces of DNA +

  10. Ribotyping - + 1% Agarose Gel cells DNA EcoRI Gel electrophoresis Transfer to nylon membrane (Southern Blot) Bind labeled 16S rDNA Probe Anti-probe Ab and enzyme-linked color reaction

  11. PFGE(Pulse Field Gel Electrophoresis) + + Agarose gel - -

  12. Repeatability and Discrimination Trial 1 Trial 2

  13. PCRpolymerase chain reaction • Invented by Kary Mullis in 1983 • Now widely used for many types of scientific research and medical diagnostics • Works by amplifying target region of DNA using: • synthetic oligonucleotides called primers • Taq polymerase enzyme • Temperature cycling

  14. Concept • Amplify small quantities of DNA by in vitro DNA replication Copies of Target DNA (amplicons) Target DNA PCR

  15. Generalized PCR cyclerepeated ca. 40 times 94 degrees Celsius-denaturation 72 degrees Celsius-extension Ca.45-60 degrees-primer annealing Taq Target sequence

  16. Primers 3’…GTATTATGGTATGCTTGCCTCTGAATGAGAATATGGCACCATCGAAA… 5’TACGAACGG primers 3’CCATCGAAA 5’…TATCGAACGGAGACTTACTCTTATACCGTGGTAGCTTTGTAATGATATT… Specificity of PCR depends on the sequence to which they bind

  17. Extension (polymerization) 3’…GTATTATGGTATGCTTGCCTCTGAATGAGAATATGGCACCATCGAAA… 5’TACGAACGG Taq Taq 3’CCATCGAAA 5’…TATCGAACGGAGACTTACTCTTATACCGTGGTAGCTTTGTAATGATATT…

  18. PCR Primers anneal to both strands of target sequence New strands of DNA are added (5’ to 3’) from the primers In subsequent cycles, primers can bind to amplicons in addition to the original DNA

  19. Amplicons increase exponentially with each cycle Single copy of dsDNA target 1st Cycle 2nd Cycle 3rd Cycle

  20. Factors that influence specificity • Stringency of conditions • Degree of primer sequence match to target sequence • Primer length • Annealing temperature • Uniqueness of target sequence • Primers will bind wherever there is a complementary target sequence

  21. Factors that influence sensitivity • Presence of necessary components • Taq • dNTPs • Magnesium • Target sequence • Primers • Presence of inhibitory chemicals • Primer hairpins and self dimers

  22. Can be used to generate qualitative or quantitative data Negative Charge L 1 2 3 - L 1 2 3 - Positive Charge

  23. Real Time PCR fluorescence Time Can be used to estimate the starting concentrations of DNA

  24. Reverse Transcriptase PCR • RNA converted to cDNA by reverse transcriptase enzyme • cDNA used to perform PCR • Used to detect specific RNA viruses • Used to test viability of cells

  25. DNA sequencing • DNA usually in the form of PCR amplicon • One strand at a time • Most thorough method of studying variation in DNA and assessing DNA similarity • Relatively expensive and time consuming (however, this is constantly improving) • Can now sequence entire genomes of organisms

  26. Extension (polymerization) 3’TAGCTTGCCTCTGAATGAGAATATGGCACCATCGAAA… 5’ATCGAACGGAGACTTACTCTTA T T A Taq A G A dNTPs are randomly- incorporated into new strand until a ‘stop’ is added T C C A G T A 3’TAGCTTGCCTCTGAATGAGAATATGGCACCATCGAAA… 5’ATCGAACGGAGACTTA Taq

  27. Possible fragments A G C T T A G If there is contradictory info, it will be read as ‘N’ T

  28. Sequence Trace

  29. DNA microarrays (Gene Chips) Labeled complementary nucleic acid binds and stimulates chip ~1cm Each block is affixed with numerous copies of a nucleic acid sequence Microarray Chip containing thousands of blocks

More Related