400 likes | 1.06k Vues
YARN MODEL OF DNA/GENES/CHROMOSOMES. The yarn represents DNA. DNA is a tiny, long, thin chemical. How does the yarn resemble DNA?. If we looked closely at the DNA inside each of your cells, it would look like a twisted ladder. .
E N D
The yarn represents DNA. DNA is a tiny, long, thin chemical. How does the yarn resemble DNA?
If we looked closely at the DNA inside each of your cells, it would look like a twisted ladder. Sort of like this…Look againat the yarn.How does the yarn remind you of DNA?
Did you notice the letters in the image of DNA? What are the four letters?
These four substances are what allow DNA to be a type of chemical code.
You’ve seen codes before. Look at this code:19-3-9-5-14-3-5 18-15-3-11-19 Anyone know what this code says?
DNA carries the information (the code) that tells your cells how to make traits. This code, for example…ATTCGTAAACGCGAATTGCTCA GATTCGTAAACGCGAATTGCTCAGmight give you dark eyes.
A section of code (DNA) that gives information for building a single trait is called a GENE. Genes
On your yarn, the different colors represent different genes. Perhaps the green section has the code for eye color.Maybe the pink section has the code for earlobe shape.
How many different genes do you have on your yarn DNA?On real DNA you might have hundreds of genes since real DNA is very, very long.
Sometimes these long, loose strands of DNA need to get organized. For example, this happens before cells divide.
Organized DNA is called a chromosome.Your next task is to create a chromosome.
Hold one end of the yarn DNA against the popsicle stick and carefully wind the yarn DNA around the stick in a single layer.
Now, you have a chromosome. Are the genes still there? How do you know?What are genes made of?
How does your model compare to this actual CHROMOSOME?This is really a duplicated (or doubled) chromosome.
Compare and Contrast DNA before and after it is in a chromosome.
Which do you think is easier to see in a microscope loose DNA or DNA organized into chromosomes? Why? DNA strands lying between 2 silicon pillars. 12/3/12
The yarn represents DNA. Explain how yarn and DNA are similar.
The yarn colors represent genes. How are the yarn colors and genes related?
DNA is a chemical code made up of 4 substances: A, T, C, and G. How is the DNA chemical code used?
Chromosomes are formed when DNA gets organized. Explain the advantages of DNA creating chromosomes.