Chapter 13: Genetic Engineering
Chapter 13: Genetic Engineering. How could you get a desired trait without directly manipulating the organisms ’ DNA?. Selective Breeding - choosing organisms with desired traits to produce the next generation Breeding the winners of a horse race (Smarty Jones)
Chapter 13: Genetic Engineering
E N D
Presentation Transcript
How could you get a desired trait without directly manipulating the organisms’ DNA? • Selective Breeding - choosing organisms withdesired traits to produce the next generation • Breeding the winners of a horse race (Smarty Jones) • Selecting a person with a certain eye color or features • Taking the seeds from the Great Pumpkin
Hybridization • Crossing organisms of different traits to produce a hardier product Ex. A mule is a cross of a horse and a donkey – Sturdy and surefooted Hybrid corn – tastes good and is more resistant to disease.
Inbreeding • Maintaining the present genes bybreeding only within the population • Ex. Pedigree animals • Risk with dipping into the same gene pool and recessive traits showing up that may be lethal or harmful.
Inducing mutations By using known mutagens, attempt to force mutations to occur • Radiation & Chemicals • Not a sure bet nor do you know what you are going to get • Polyploidy (3N or 4N) plants have resulted from this – larger & hardier
Glofish: the first genetically modified animal to be sold as a pet
Now let’s manipulate the genes by altering the organism’s DNA • DNA Technology – science involved in the ability to manipulate genes/DNA • Purpose: • Cure disease (Cystic Fibrosis) • Treat genetic disorders (Hemophilia, diabetes) • Improve food crops (better tasting, longer shelf life, fungus resistance…) • Improve human life in general
The Tools: • DNA Extraction – Chemical procedure (we’ll do this) • Restriction enzymes– molecular scissors that cut DNA at specific nucleotide sequences • Gel Electrophoresis– method to analyze fragments of DNA cut by restriction enzymes through a gel made of agarose (molecular sieve) • DNA Ligase – molecular glue that puts pieces of DNA together • Polymerase Chain Reaction (PCR)- molecular copy machine. Makes millions of copies of DNA/hr
Let’s suppose that you are a diabetic and can not make your own insulin. What are you to do? • Inject insulin of course but from what source? • Old method was to use sheep insulin. Costly and labor intensive • New method: Let bacteria with a human insulin producing gene make it for you
The Method: • Transformation of a bacterium to produce human insulin 1. Extract the insulin producing gene from a healthy human 2. Using a restriction enzyme, cut the insulin producing gene out of a the DNA
What are restriction enzymes? • Bacterial enzymes – used to cut bacteriophage DNA (viruses that invade bacteria). • Different bacterial strains express different restriction enzymes • Restriction enzymes recognize a specific short nucleotide sequence • For example, Eco RI recognizes the sequence: • 5’ - G A A T T C - 3’ • 3’ - C T T A A G - 5’ • Pandindrones same base pairing forward and backwards
Let’s try some cutting: • Using this piece of DNA, cut it with Eco RI • G/AATTC • GACCGAATTCAGTTAATTCGAATTC • CTGGCTTAAGTCAATTAAGCTTAAG • GACCG/AATTCAGTTAATTCG/AATTC • CTGGCTTAA/GTCAATTAAGCTTAA/G
What results is: • GACCG AATTCAGTTAATTCG AATTC • CTGGCTTAA GTCAATTAAGCTTAA G Sticky end - tails of DNA – easily bindto other DNA strands Sticky end
Blunt & Sticky ends • Sticky ends – Creates an overhang. EcoRI • Blunts- Enzymes that cut at precisely opposite sites without overhangs. SmaI is an example of an enzyme that generates blunt ends
3. Cut cloning vector: • Use bacterial plasmids • Plasmids will be cut with the same restriction enzyme used to cut the desired gene
4. Ligation - Donor gene (desired gene) is then spliced or annealed into the plasmid using DNA ligase as the glue. Recombinant DNA - DNA with new piece of genetic information on it • 5. Plasmid is then returned to bacterium and reproduces with donor gene in it. Transgenic organism – organism with foreign DNA incorporated in its genome (genes) • 6. Bacterium reproduces and starts producing human insulin gene which we harvest from them.
Recombinant DNA Donor Gene
Expression of Cloned Genes Sometimes PROMOTERS must also be transferred so the genes will be turned on. Genes are often turned off until the proteins they code for are needed.
Practical Use of DNA technology • Pharmaceutical products – insulin, HBCF (human blood clotting factor) • Genetically engineered vaccines – to combat viral infections (pathogenic – disease causing) – your body recognizes foreign proteins, produces antibodies. Introduced viral proteins will trigger an immune response and the production of antibodies
3. Increasing agricultural yields – • New strains of plants – GMO – Genetically modifiedorganism • Insect resistant plants – Insert gene that digests larvae when larvae try to eat the plant – Not always specific to harmful species!! – Monarch problem • Disease resistance – Fungal resistance in tomatoes, corn, soybean • Herbicide resistance - *Round Up won’t harm the good plants, only the bad plants (weeds) – cheaper and less labor extensive than weeding • Getting genes from Nitrogen fixing bacteria inserted into plants – fix their own nitrogen (a must for plants) in N poor soils • Salt tolerant plants – can grow plants where high concentrations of salt in the air or soil
Improve quality of produce - Slow down the ripening process – ship when un-ripened, to market when ripe - Enhance color of produce - Reduce hairs or fuzz on produce - Increase flavor - Frost resistance
The negatives • Problem with transgenic foods is that an introduced gene may produce a protein that someone may be sensitive to. • FDA does not require that on a label (here in the US) • If a label starts with a “(8), then it’s a GMO product – 84011 = GMO banana • Also, may create “superweeds” that cross pollinate with others & may take over environment
Cloning • Growing a population of genetically identical cells from a single cell. • 1997 - Ian Wilmut with Dolly, the cloned sheep • Remove nucleus from egg cell • Fuse de-nucleated cell with a body cell from another adult • Cells fuse to become 2N and then divides • Implant embryo in reproductive system of foster mother
DNA Fingerprinting • Using cut DNA at specific sites to determine the source of the DNA. • Analyzes sections of DNA that have little to no function but vary greatly from one person to the next (called repeats) • RFLP analysis
How is it done? • RFLP analysis – Restriction fragment length polymorphism. We each have non-coding segments on our DNA. (Old genes) • Extract DNA sample from blood or tissues • Cut DNA using restriction enzymes. Fragment lengths varies with each person • Separate fragments by gel electrophoresis– separates DNA fragments by the # of base pairs (length of the fragment) and charge 4. Place DNA sample into wells in the agarose gel – molecular sieve 5. Run a current through the gel. The DNA (negatively charged) will migrate from (-) to (+) • The larger fragments will not migrate that far. The small fragments will go the furthest. 7. Stain gel and bands in a dye or use a radioactive probe to analyze the banding
Objective #10 - 12: • Electrophoresis “electro” = electricity “phoros” = to carry across • Makes it possible to determine the genetic differences and the evolutionary relationship among species of organisms • Method that separates macromolecules (Nucleic acids or proteins) on the basis of size, electric charge and other physical properties
Who did it? Suspect #1 or #2 • #1’s fingerprint matches the evidence left. • Neither Suspect #2 nor the Victim matches #1. • Therefore, #1 did it!!
Your VNTRs are inherited from your parents Shown below are the VNTR patterns for Mrs. Nguyen [blue],& Mr. Nguyen [yellow] • Their four children: • D1 (the Nguyens' biological daughter) • D2 (Mr. Nguyen's step-daughter, child of Mrs. Nguyen and her former husband [red]) • S1 (the Nguyens' biological son) • S2 (the Nguyens' adopted son, not biologically related [his parents are light and dark green]).
Gene Therapy • Treatment of a genetic disorder (like cystic fibrous) by correcting a defective gene that causes a deficiency of an enzyme. • Nasal spray that carries normal enzyme gene. Body makes enzyme and patient breathes normally. Regular treatments necessary • Has not been proven to be successful in the long term