sugar
Uploaded by
19 SLIDES
345 VUES
190LIKES

Chapter 13: Genetic Engineering

DESCRIPTION

Chapter 13: Genetic Engineering. DNA Technology – science involved in the ability to manipulate genes/DNA Purpose: Cure disease (Cystic Fibrosis) Treat genetic disorders (Hemophilia, diabetes) Improve food crops (better tasting, longer shelf life, fungus resistance…)

1 / 19

Télécharger la présentation

Chapter 13: Genetic Engineering

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Chapter 13: Genetic Engineering

  2. DNA Technology – science involved in the ability to manipulate genes/DNA • Purpose: • Cure disease (Cystic Fibrosis) • Treat genetic disorders (Hemophilia, diabetes) • Improve food crops (better tasting, longer shelf life, fungus resistance…) • Improve human life in general • Helps us ID genes for traits DNA Technology

  3. Selective Breeding - choosing organisms withdesired traits to produce the next generation • Breeding the winners of a horse race (Smarty Jones) • Taking the seeds from the Great Pumpkin How could you get a desired trait without directly manipulating the organisms’ DNA?

  4. Crossing organisms of different traits to produce a hardier product Ex. A mule is a cross of a horse and a donkey – Sturdy and surefooted Hybrid corn – tastes good and is more resistant to disease. Hybridization

  5. Maintaining the present genes bybreeding only within the population • Ex. Pedigree animals • Risk with dipping into the same gene pool and recessive traits showing up that may be lethal or harmful. Inbreeding

  6. By using known mutagens, attempt to force mutations to occur • Radiation & Chemicals • Not a sure bet nor do you know what you are going to get • Polyploidy (3N or 4N) plants have resulted from this – larger & hardier Inducing mutations

  7. Treatment of a genetic disorder (like cystic fibrous) by correcting a defective gene that causes a deficiency of an enzyme. • Nasal spray that carries normal enzyme gene. Body makes enzyme and patient breathes normally. Regular treatments necessary • Has not been proven to be successful in the long term DNA Technology: ex: Gene Therapy

  8. DNA Extraction – Chemical procedure (we’ll do this) • Restriction enzymes– molecular scissors that cut DNA at specific nucleotide sequences • Gel Electrophoresis– method to analyze fragments of DNA cut by restriction enzymes through a gel made of agarose (molecular sieve) • DNA Ligase – molecular glue that puts pieces of DNA together • Polymerase Chain Reaction (PCR)- molecular copy machine. Makes millions of copies of DNA/hr The Tools:

  9. Inject insulin of course but from what source? • Old method was to use sheep insulin. Costly and labor intensive • New method: Let bacteria with a human insulin producing gene make it for you Let’s suppose that you are a diabetic and can not make your own insulin. What are you to do?

  10. Transformation of a bacterium to produce human insulin 1. Extract the insulin producing gene from a healthy human 2. Using a restriction enzyme, cut the insulin producing gene out of a the DNA The Method:

  11. Bacterial enzymes – used to cut bacteriophage DNA (viruses that invade bacteria). • Different bacterial strains express different restriction enzymes • Restriction enzymes recognize a specific short nucleotide sequence • For example, Eco RI recognizes the sequence: • 5’ - G A A T T C - 3’ • 3’ - C T T A A G - 5’ • Pandindrones same base pairing forward and backwards What are restriction enzymes?

  12. Using this piece of DNA, cut it with Eco RI • G/AATTC • GACCGAATTCAGTTAATTCGAATTC • CTGGCTTAAGTCAATTAAGCTTAAG • GACCG/AATTCAGTTAATTCG/AATTC • CTGGCTTAA/GTCAATTAAGCTTAA/G Let’s try some cutting:

  13. GACCG AATTCAGTTAATTCG AATTC • CTGGCTTAA GTCAATTAAGCTTAA G Sticky end - tails of DNA – easily bindto other DNA strands Sticky end What results is:

  14. Sticky ends – Creates an overhang. EcoRI • Blunts- Enzymes that cut at precisely opposite sites without overhangs. SmaI is an example of an enzyme that generates blunt ends Blunt & Sticky ends

  15. Use bacterial plasmids • Plasmids will be cut with the same restriction enzyme used to cut the desired gene 3. Cut cloning vector:

  16. 4. Ligation - Donor gene (desired gene) is then spliced or annealed into the plasmid using DNA ligase as the glue. Recombinant DNA - DNA with new piece of genetic information on it • 5. Plasmid is then returned to bacterium and reproduces with donor gene in it. Transgenic organism – organism with foreign DNA incorporated in its genome (genes) • 6. Bacterium reproduces and starts producing human insulin gene which we harvest from them.

  17. Recombinant DNA Donor Gene

More Related