'Jukes cantor' diaporamas de présentation

622 views • 62 slides

Introduction to

Introduction to. Bioinformatics. Introduction to Bioinformatics. LECTURE 5: Variation within and between species * Chapter 5: Are Neanderthals among us?. Neandertal, Germany, 1856. Initial interpretations: * bear skull * pathological idiot * Old Dutchman.

770 views • 58 slides

Introduction to

Introduction to. Bioinformatics. Introduction to Bioinformatics. LECTURE 5: Variation within and between species * Chapter 5: Are Neanderthals among us?. Neandertal, Germany, 1856. Initial interpretations: * bear skull * pathological idiot * Old Dutchman.

584 views • 58 slides

Statistical tree estimation

Statistical tree estimation. Tandy Warnow. Topics: March 6-15. Stochastic models of sequence evolution Distance-based estimation Maximum parsimony tree estimation Maximum likelihood tree estimation Bayesian tree estimation. March 6, 2017. Two sequence evolution models:

667 views • 49 slides

RNA Secondary Structure

RNA Secondary Structure. aagacuucggaucuggcgacaccc uacacuucggaugacaccaaagug aggucuucggcacgggcaccauuc ccaacuucggauuuugcuaccaua aagccuucggagcgggcguaacuc. Decoding: the CYK algorithm. Given x = x 1 ....x N , and a SCFG G, Find the most likely parse of x

535 views • 44 slides

Phylogeny Tree Reconstruction

1. 4. 3. 5. 2. 5. 2. 3. 1. 4. Phylogeny Tree Reconstruction. Inferring Phylogenies. Trees can be inferred by several criteria: Morphology of the organisms Sequence comparison Example: Orc: A C A G T G A C G CCCC AAA C G T Elf: A C A G T G A C G C T A C AAA C G T

486 views • 40 slides

Distance Methods

Distance Methods. Distance Methods. Distance Estimates attempt to estimate the mean number of changes per site since 2 species (sequences) split from each other

509 views • 38 slides

Distance Methods

Distance Methods. Distance Methods. Distance Estimates attempt to estimate the mean number of changes per site since 2 species (sequences) split from each other

530 views • 38 slides

Distance Methods

Distance Methods. Distance Methods. Distance Estimates attempt to estimate the mean number of changes per site since 2 species (sequences) split from each other

398 views • 38 slides

Models of Evolution

Models of Evolution. Majid Kazemian. Introduction. Probabilistic Model of Indels Model of an arbitrary distribution of indel lengths (TKF Model) MCALIGN We have seen above models in the course Models of Nucleotide Substitution Jukes Cantor model Kimura model. Phylogeny Tree .

452 views • 28 slides

Overview of Phylogeny

1. 4. 3. 5. 2. 5. 2. 3. 1. 4. Overview of Phylogeny. Edentata (anteaters, sloths, armadillos). New World monkeys. Old World monkeys. Lagomorpha (rabbits). humans, gorilla, chimpanzee, orangutan. Triconodonts. Rodentia (mice, rats, squirrels). gibbons. Multituberculata.

418 views • 28 slides

Presentation partially taken from Dan Geiger, modified by Benny Chor.

Maximum Likelihood ( ML ) Parameter Estimation with applications to inferring phylogenetic trees Comput. Genomics, lecture 7a. Background reading: Durbin et al Chapter 8. Presentation partially taken from Dan Geiger, modified by Benny Chor. Our Probabilistic Model (Reminder).

420 views • 27 slides

Phylogeny Tree Reconstruction

1. 4. 3. 5. 2. 5. 2. 3. 1. 4. Phylogeny Tree Reconstruction. Inferring Phylogenies. Trees can be inferred by several criteria: Morphology of the organisms Sequence comparison Example: Orc: A C A G T G A C G CCCC AAA C G T Elf: A C A G T G A C G C T A C AAA C G T

390 views • 25 slides

Phylogeny Tree Reconstruction

1. 4. 3. 5. 2. 5. 2. 3. 1. 4. Phylogeny Tree Reconstruction. Inferring Phylogenies. Trees can be inferred by several criteria: Morphology of the organisms Sequence comparison Example: Orc: A C A G T G A C G CCCC AAA C G T Elf: A C A G T G A C G C T A C AAA C G T

346 views • 25 slides

Phylogenetic Trees Lecture 3

542 views • 21 slides

Phylogenetic Trees Lecture 4

444 views • 21 slides

Computing a tree

318 views • 19 slides