'Optimal alignment' diaporamas de présentation

Analyzing Sequences

Analyzing Sequences. Sequences: An Evolutionary Perspective. Evolution occurs through a set of modifications to the DNA These modifications include point mutations, insertions, deletions, and rearrangements

1.52k views • 135 slides

Kognitio Console Training November 2012

Kognitio Console Training November 2012. November 2012. Using this slide deck. All title slides are hyperlinked for easy navigation simply click on the relevant section/topic you are interested in or view the deck in order for the full course

1.47k views • 111 slides

DNA1: (Last week)

DNA1: (Last week). Types of mutants Mutation, drift, selection Binomial for each Association studies c 2 statistic Linked & causative alleles Alleles, Haplotypes, genotypes Computing the first genome, the second ... New technologies Random and systematic errors.

598 views • 52 slides

Sequence Alignments and Dynamic Programming

768 views • 49 slides

Inverse Alignment

Inverse Alignment. CS 374 Bahman Bahmani Fall 2006. The Papers To Be Presented. Sequence Comparison - Alignment. Alignments can be thought of as two sequences differing due to mutations happened during the evolution. AGGCTATCACCTGACCTCCAGGCCGATGCCC TAGCTATCACGACCGCGGTCGATTTGCCCGAC.

563 views • 46 slides

CS 5263 Bioinformatics

577 views • 46 slides

Alignment

Alignment. Introduction. Notes courtesy of Funk et al. , SIGGRAPH 2004. Outline: Challenge General Approaches Specific Examples. Translation. Rotation. Scale. Alignment. Challenge : The shape of a model does not change when acted on by similarity transformations:. =. Alignment.

643 views • 45 slides

Introduction to Sequence Alignment

Introduction to Sequence Alignment. Why Align Sequences?. Find homology within the same species Find clues to gene function Practical issues in experiments Find homology in other species Gather info for an evolutionary model Gene families. The Most Visual Way of Aligning Two Sequences.

1.21k views • 41 slides

EX3

EX3. Sequence Alignment: BLAST and Psi-BLAST. Outline. Pairwise alignment : Alignment with gaps Global alignment Local alignment Blast: NCBI BLAST web server NCBI PSI-BLAST web server BLAST through Chimera. Introduction. The Limits of Sequence Similarity. Introduction.

619 views • 40 slides

ALIGNMENT OF NUCLEOTIDE & AMINO-ACID SEQUENCES

ALIGNMENT OF NUCLEOTIDE & AMINO-ACID SEQUENCES.

538 views • 40 slides

Sequence Analysis Tools

Sequence Analysis Tools. Erik Arner Omics Science Center, RIKEN Yokohama, Japan arner@gsc.riken.jp. Aim of lecture. Why align sequences? How are sequences aligned to each other? Variants Limitations Basic understanding of common tools for Similarity search Multiple alignment.

734 views • 39 slides

Applications of Dynamic Programming

Applications of Dynamic Programming. To sequence analysis Shotgun sequence assembly Multiple alignments Dispersed & tandem repeats Bird song alignments Gene Expression time-warping 3D-structure alignment Through HMMs RNA gene search & structure prediction Distant protein homologies

688 views • 39 slides

CSE 182-L2:Blast & variants I Dynamic Programming

CSE 182-L2:Blast & variants I Dynamic Programming. www.cse.ucsd.edu/classes/ fa09/ cse182. www.cse.ucsd.edu/~vbafna. Notes. Assignment 1 is online, due next Tuesday. Discussion section is optional. Use it as a resource.

483 views • 38 slides

Similarity Methods

974 views • 28 slides

Exploring Protein Sequences

Tutorial 5. Exploring Protein Sequences. Exploring Protein Sequences. Multiple alignment ClustalW Motif discovery MEME Jaspar. A. C. D. B. Multiple Sequence Alignment. More than two sequences DNA Protein Evolutionary relation Homology ? Phylogenetic tree Detect motif.

431 views • 27 slides

Dynamic Programming: BLAST

428 views • 27 slides

Implementation of Planted Motif Search Algorithms PMS1 and PMS2

Implementation of Planted Motif Search Algorithms PMS1 and PMS2. Clifford Locke BioGrid REU, Summer 2008 Department of Computer Science and Engineering University of Connecticut, Storrs, CT. Introduction. General Problem: Multiple Sequence Comparison Biological Basis DNA structure/function

242 views • 17 slides

Sequence Alignments

402 views • 17 slides

Introduction

Introduction. an orthodontic treatment procedure that involves the orderly removal of selected deciduous and permanent teeth in a predetermined sequence { Dewel 1969]. Definition.

268 views • 11 slides

Optimal Sum of Pairs Multiple Sequence Alignment

351 views • 9 slides