1 / 35

Potential Application in TCM Research: Polyamines and mRNA Stability in Epithelial Cells

2006 World Congress on Chinese Medicine/Hong Kong. Potential Application in TCM Research: Polyamines and mRNA Stability in Epithelial Cells. Jian-Ying Wang, MD, Ph.D University of Maryland School of Medicine. a) Normal b) Atrophy. Specific regulation of gut mucosal growth.

shelby
Télécharger la présentation

Potential Application in TCM Research: Polyamines and mRNA Stability in Epithelial Cells

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. 2006 World Congress on Chinese Medicine/Hong Kong Potential Application in TCM Research: Polyamines and mRNA Stability in Epithelial Cells Jian-Ying Wang, MD, Ph.D University of Maryland School of Medicine

  2. a) Normal b) Atrophy

  3. Specific regulation of gut mucosal growth • Gut mucosa is affected by its own set of hormones such as gastrin, EGF, and CCK • The mucosa is exposed to a variety of luminal constituents and factors

  4. Polyamines • Polyamines are organic cations found in all eukaryotic cells • Polyamines are intimately involved in, and required for, distinct biological functions • To be required for cell proliferation • To induce cell migration • To stabilize cell membrane • To be involved in apoptosis • To modulate membrane channel activity

  5. Polyamine Biosynthesis Hormones DFMO - + Growthfactors Antizyme Nutrients DN-ODC Damage CO2 + NH3 + - H3N O Ornithine O Ornithine decarboxylase + + H3N NH3 Putrescine H H + + + N H3N NH3 Spermidine H H + + H3N N + N NH3 + H H Spermine

  6. Polyamines and Gastrointestinal mucosal growth • GI mucosal growth depends on the supply of polyamines to the dividing cells in the crypts • Polyamines are essential for stimulation of IEC proliferation, at least in part, by inhibiting expression of p53 and nucleophosmin (NPM) genes • Decreasing cellular polyamines induces posttranscription, but not transcription, of p53 and NPM

  7. p53 expression in intestinal mucosa after polyamine depletion A. p53 mRNA DFMO+PA Control DFMO -p53 -GAPDH 1 2 3 B. p53 Protein kDa -p53 46- 1 2 3 Am J Physiol 281:C441, 2001

  8. DNA synthesis after polyamine depletion in vivo

  9. p53 expression in cultured IECs after polyamine depletion A B a. p53 mRNA a. p53 gene transcription DFMO+SPD DFMO+SPD Control DFMO Control DFMO -p53 -p53 -pCRTMII -GAPDH -GAPDH 1 2 3 4 5 6 b. Relative mRNA Levels b. Relative Transcription Rate 1 2 3 1 2 3

  10. Cytoplasmic half-life studies of p53 mRNA in IECs after polyamine depletion A B a. Control 0 20 40 60 80 160 Time (min) -p53 -GAPDH b. DFMO 0 60 120 240 480 960 Time (min) -p53 -GAPDH c. DFMO+SPD 0 20 40 60 80 160 Time (min) -p53 Gastroenterology 123:764, 2002 -GAPDH

  11. Cytoplasmic half-life studies of NPM mRNA in IECs following polyamine depletion A B Control DFMO DFMO+PUT Marker 0 30 60 120 240 0 60 120 240 360 0 30 60 120 240 400- 300- -NPM 200- 100- 400- -Actin 300- 200- Am J Physiol 289:C686, 2005

  12. Intestinal epithelial cell proliferation following polyamine depletion in vitro A. Growth B. G1 Phase Cells * Control DFMO+SPD Cell Numbers (×106) % Cells in G1 Phase DFMO Con DFMO DFMO + SPD Time (days)

  13. HuR protein • HuR is a RNA-binding protein and regulates the stability and translation of target mRNAs • HuR is predominantly (>90%) present in the nucleus of unstimulated cells, but can be exported to the cytoplasm in response to stress • HuR specifically binds to U- and UA-rich elements located in the 3’-untranslated regions (3’-UTRs) of target mRNAs

  14. Increased cytoplasmic levels of HuR following polyamine depletion 4 days 6 days DFMO+PUT DFMO+PUT Control Control DFMO DFMO kDa 34- -HuR Cytoplasmic -Actin 42- 67- -Lamin B -HuR 34- Nuclear -Lamin B 67- Total -HuR 34- J Biol Chem 281:19387, 2006

  15. Cellular distribution of HuR after polyamine depletion Control DFMO DFMO+PUT

  16. Characterization of stable ODC-transfected IEC cells A B Vector alone ODC-IEC-C1 ODC-IEC-C2 Parent IEC-6 ODC Activity (pmol/h/mg protein) -ODC -Actin 1 2 3 4 1 2 3 4 Biochem J398:257, 2006

  17. Changes in HuR protein in stable ODC-IEC cells ODC-IEC-C1 ODC-IEC-C2 Vector alone kDa 34- -HuR Cytoplasmic 42- -Actin 67- -Lamin B 34- -HuR Nuclear 34- -Lamin B 34- Total -HuR

  18. UA-rich sequences in 3'-UTR of p53 mRNA p53 mRNA 5’UTR CR 3’UTR 1 2629 252 CR 1434 3’UTR 2181 ucaauuucuuuuuucuuuuuuuuuuuuuuuuuucuuuuucuuu 2223 2574 uuuuuauacccauuuuuauaucgaucucuuauuuuacaauaaaacuuu 2622

  19. Induced cytoplasmic HuR directly binds to 3'-UTR of p53 mRNA A. Binding to 3'-UTR 4 days 6 days DFMO+PUT DFMO+PUT Control Control DFMO DFMO kDa 34- -HuR -Actin 42- B. Binding to CR kDa 34- -HuR

  20. UA-rich sequences in 3'-UTR of NPM mRNA NPM mRNA 5’UTR CR 3’UTR 1 1304 97 CR 981 3’UTR 983 aaaauaguuuaaacaauuuguuaaaaaauuuu 1114 1257aaaaauauacaugugaaauaaaacucaguauuuuaauaaaguaaaa 1304

  21. Induced cytoplasmic HuR directly binds to 3'-UTR of NPM mRNA A. Binding to 3'-UTR 6 days 4 days DFMO+PUT DFMO+PUT Control Control DFMO DFMO kDa 34- -HuR 42- -Actin B. Binding to CR 34- -HuR

  22. The binding of endogenous HuR to endogenous NPM and p53 mRNAs A B +HuR +IgG1 a. NPM mRNA b. p53 mRNA Control Control Marker DFMO DFMO * * bp Relative mRNA levels 300- -NPM 200- 600- 400- -p53 300- Control DFMO Control DFMO

  23. Effect of transfection with specific siRNA on levels of HuR in polyamine-deficient cells DFMO C-siRNA Control SiHuR kDa 34- -HuR 42- -Actin

  24. Effect of HuR inhibition by siRNA on stability of p53 and NPM mRNAs A B DFMO a. NPM mRNA b. p53 mRNA C-siRNA Control DFMO +C-siRNA SiHuR kDa 38- -NPM DFMO +siHuR % RNA remaining Control -p53 53- 42- -Actin Time (min) Time (min)

  25. AMP-activated protein kinase (AMPK) and importin-1 • AMPK is an enzyme involved in responding to metabolic stress • Recently, AMPK is shown to induce an accumulation of nuclear HuR • The effect of AMPK on HuR nuclear translocation is mediated through importin-1 , an adaptor protein involved in nuclear import

  26. Changes in levels of AMPK in IEC-6 cells after polyamine depletion 4 days 6 days DFMO+PUT DFMO+PUT Control DFMO Control DFMO kDa Total 62- -AMPK Nuclear 62- -AMPK 62- -AMPK -Phospho-AMPK Cytoplasmic 62- 42- -Actin

  27. Changes in AMPK and Importin-1 in cells overexpressing ODC A. AMPK B. Importin-1 ODC-IEC-C2 ODC-IEC-C2 ODC-IEC-C1 ODC-IEC-C1 Vector alone Vector alone -Cytoplasmic -Nuclear -Total -Actin

  28. Effects of overexpression of AMPK on cytoplasmic HuR in polyamine-deficient cells AdAMPK(pfu/cell) 0 10 50 100 -AMPK 62- 62- -Phospho-AMPK 60- -Importin-1 -HuR 34- 42- -Actin

  29. Effects of overexpression of AMPK on levels of cytoplasmic HuR in control cells AdAMPK(pfu/cell) 0 10 50 100 62- -AMPK 62- -Phospho-AMPK -Importin-1 60- 34- -HuR 55- -Tubulin

  30. Importin-1 Constructs Ac P Importin-1 22 105 529 Lys Ser Imp1 (K22R) 22 Imp1 (S105A) 105 Imp1 (K22R/S105A) 22 105

  31. Characterization of stable importin-1-transfected IEC-6 cells Mut-Impα1 K22R/S105A WT-Imp-1 Vector alone K22R S105A -His-Tag -β-Tubulin

  32. Changes in cytoplasmic levels of HuR in IECs overexpressing wide-type or mutated importin-1 Mut-Impα1 K22R/S105A WT-Imp-1 Vector alone K22R S105A -HuR Cytoplasmic -β-Tubulin -HuR Total -β-Tubulin

  33. Effect of increased AMPK on cytoplasmic HuR levels in mutated importin-α1-transfected IEC cells A. IEC-6 cells B. Mutated Imp-IEC cells Null AdAMPK K22R/S105A K22R/S105A AdAMPK S105A S105A K22R K22R Null -AMPK -HuR (Cyto) -HuR (Total) -β-Tubulin

  34. mRNA 5‘-UTR CR 3‘-UTR aaaauaguuuaaacaauuuguuaaaaaauuuu HuR HuR HuR HuR mRNA stability Polyamines HuR mRNA levels AMPK/Imp-α NPM HuR p53 Protein expression NPM p53 p21 gene p21 activity Cell Proliferation

  35. Collaborators:Myriam Gorospe, Ph.D (NIH) Robert A. Casero, Jr. Ph.D (JHU) Wang’s Lab:Jaladanki N. Rao, Ph.D Li Li, MDJi Li, MD Anami R. Patel, Ph.DXin Guo, MD, Ph.D Lan Liu, MDLan Xiao, MD Ai-Hong Zhang, Ph.DTongtong Zhou, Ph.D Huifang M. Zhang, Ph.D Douglas J. Turner, MD Eric D. Strauch, MDBernard S. Marsa, MS Kaspar M. Keledjian, MDJie Chen, Ph.D Jose Greenspon, MD

More Related