Transcription
Transcription. from ______________________ language ____ _______________________ language. Transcription. Making mRNA _______________ DNA strand = ____________strand _________________ DNA strand = ________________ same sequence as RNA synthesis of complementary RNA strand
Transcription
E N D
Presentation Transcript
Transcription from______________________ language____ _______________________ language
Transcription • Making mRNA • _______________ DNA strand = ____________strand • _________________ DNA strand = ________________ • same sequence as RNA • synthesis of complementary RNA strand • ______________________ • enzyme • ______________________ coding strand 3 A G C A T C G T 5 A G A A A C G T T T T C A T C G A C T DNA 3 C T G A A 5 T G G C A U C G U T C unwinding 3 G T A G C A rewinding mRNA template strand RNA polymerase 5 build RNA 53
Which gene is read? • _______________ region • binding site before beginning of gene • ______________ binding site • ___________________________________________________________________________________ • Enhancer region • binding site far upstream of gene • turns transcription on HIGH
Transcription Factors • Initiation complex • __________________________________________ • suite of proteins which bind to DNA • hormones? • turn on or off transcription • _________________________________________
RNA polymerase Matching bases of DNA & RNA A • RNA POLYMERASE: _______________________ bases on one of the DNA strands C U G A G G U C U U G C A C A U A G A C U A 5' 3' G C C A T G G T A C A G C T A G T C A T C G T A C C G T
intron = noncoding (inbetween) sequence exon = coding (expressed) sequence Eukaryotic genes have junk! • Eukaryotic genes are not continuous • __________________________ • expressed / coding DNA • _________________________ • inbetween sequence intronscome out! eukaryotic DNA
intron = noncoding (inbetween) sequence exon = coding (expressed) sequence mRNA ______________ • Post-transcriptional processing • eukaryotic mRNA needs work after transcription • primary transcript = ______________ • mRNA ________________ • _________________ • make ________________________ ~10,000 bases eukaryotic DNA pre-mRNA primary mRNA transcript ~1,000 bases mature mRNA transcript spliced mRNA
Splicing must be accurate • No room for mistakes! • a __________________________________________________________ AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGUCCGAUAAGGGCCAU AUG|CGG|UCC|GAU|AAG|GGC|CAU Met|Arg|Ser|Asp|Lys|Gly|His AUGCGGCTATGGGUCCGAUAAGGGCCAU AUGCGGGUCCGAUAAGGGCCAU AUG|CGG|GUC|CGA|UAA|GGG|CCA|U Met|Arg|Val|Arg|STOP|
snRNPs snRNA intron exon exon 5' 3' spliceosome 5' 3' lariat 5' 3' exon exon mature mRNA excised intron 5' 3' RNA splicing enzymes • ____________ • small nuclear RNA • proteins • ______________ • several snRNPs • ________________________________ • cut & paste gene No, not smurfs! “snurps”
Alternative splicing • _____________________________________ • when is an intron not an intron… • different segments treated as exons Starting to gethard to define a gene!
3' poly-A tail 3' A A A A A mRNA 50-250 A’s 5' cap P P P 5' G More post-transcriptional processing • _________________________ on its trip from nucleus to cytoplasm • enzymes in cytoplasm attack mRNA • _______________________________ • add _____________ • add ______________ • longer tail, mRNA lasts longer: produces more protein
aa aa aa aa aa ribosome aa aa aa aa aa aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein trait