stella
Uploaded by
23 SLIDES
651 VUES
240LIKES

Transcription

DESCRIPTION

Transcription. Gene 2. DNA molecule. Gene 1. Gene 3. DNA strand (template). 5. 3. A. C. C. T. A. A. A. C. C. G. A. G. TRANSCRIPTION. A. U. C. G. C. U. G. G. G. U. U. U. 5. mRNA. 3. Codon. TRANSLATION. Gly. Phe. Protein. Trp. Ser. Figure 17.4.

1 / 23

Download Presentation
Télécharger la présentation

Transcription

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Transcription

  2. Gene 2 DNA molecule Gene 1 Gene 3 DNA strand (template) 5 3 A C C T A A A C C G A G TRANSCRIPTION A U C G C U G G G U U U 5 mRNA 3 Codon TRANSLATION Gly Phe Protein Trp Ser Figure 17.4 Amino acid

  3. Second mRNA base U C A G U UAU UUU UCU UGU Tyr Cys Phe UAC UUC UCC UGC C U Ser UUA UCA UAA Stop Stop UGA A Leu UAG UUG UCG Stop UGG Trp G CUU CCU U CAU CGU His CUC CCC CAC CGC C C Arg Pro Leu CUA CCA CAA CGA A Gln CUG CCG CAG CGG G Third mRNA base (3 end) First mRNA base (5 end) U AUU ACU AAU AGU Asn Ser C lle AUC ACC AAC AGC A Thr A AUA ACA AAA AGA Lys Arg Met or start G AUG ACG AAG AGG U GUU GCU GAU GGU Asp C GUC GCC GAC GGC G Val Ala Gly GUA GCA GAA GGA A Glu Figure 17.5 GUG GCG GAG GGG G • A codon in messenger RNA • Is either translated into an amino acid or serves as a translational start or stop signal

  4. The following is the sequence of a bases on the template strand of DNA in the transcription unit 3’ – GGATCAGGTCCAGGCAATTTAGCATGCCCC – 5’ • Transcribe this sequence into mRNA • List the order of amino acids

  5. Four Major Steps • Initiation • Elongation • Termination • Posttranscriptional Modification

  6. Parts of a Gene • promoter - DNA sequences which indicate the location of a gene • promoters are located upstream from the DNA region that contains the information to be transcribed into mRNA gene promoter transcription region termination sequence

  7. Orientation About a Gene upstream downstream • RNA polymerase – transcription enzyme (synthesizes mRNA in 5’  3’ direction) • uses upstream, promoter region to determine where to start mRNA transcription 0 negative numbers positive numbers start transcription

  8. Initiation • dsDNA (double stranded DNA) needs to be opened for mRNA to be made • promoter regions are often sequences of A’s and T’s • 2 H-bonds between A&T • easier to break than 3 H-bonds between G&C • prokaryotic genes have a TATA box • RNA polymerase opens the dsDNA

  9. Eukaryotic promoters 1 TRANSCRIPTION DNA Pre-mRNA RNA PROCESSING mRNA Ribosome TRANSLATION Polypeptide Promoter 5 3 A T A T A A A A T A T T T T 3 5 TATA box Start point Template DNA strand Several transcription factors 2 Transcription factors 5 3 3 5 Additional transcription factors 3 RNA polymerase II Transcription factors 3 5 5 3 5 RNA transcript Figure 17.8 Transcription initiation complex Initiation • transcription factors - numerous protein factors are involved in starting transcription • some of these proteins help control how often genes are transcribed

  10. Non-template strand of DNA Elongation RNA nucleotides RNA polymerase T A C C A T A C T 3 G 3 end T G A U G G A C C C A U C A 5 A A T A G G T T Direction of transcription (“downstream”) 5 Template strand of DNA Newly made RNA Elongation • RNA polymerase synthesizes mRNA in the 5’  3’ direction • no primer is necessary • template strand - only one strand of the DNA is transcribed

  11. Elongation Nomenclature • the template strand is copied into mRNA strand also known as the antisense strand 5’ A T T A C G A T C T G C A C A A G A T C C T 3’ DNA 3’ T A A T G C T A G A C G T G T T C T A G G A 5’ mRNA ANTISENSE STRAND 5’ A U U A C G A U C U G C A C A A G A U C C U 3’ SENSE STRAND

  12. Termination • RNA polymerase stops transcribing once it reaches the termination sequence • enzyme dissociates with DNA strand and binds to another promoter sequence • termination sequences differ between prokaryotes and eukaryotes

  13. Transcription

  14. Transcription Animation http://www.youtube.com/watch?v=WsofH466lqk Start watching at 1:30.

  15. 1 3 2 Promoter Transcription unit 5 3 3 5 Start point DNA RNA polymerase Initiation. After RNA polymerase binds to the promoter, the DNA strands unwind, and the polymerase initiates RNA synthesis at the start point on the template strand. 5 3 3 5 Template strand of DNA Unwound DNA RNA transcript Elongation. The polymerase moves downstream, unwinding the DNA and elongating the RNA transcript 5  3 . In the wake of transcription, the DNA strands re-form a double helix. Rewound RNA 5 3 3 5 3 RNA transcript 5 Termination. Eventually, the RNA transcript is released, and the polymerase detaches from the DNA. 5 3 3 5 3 5 Completed RNA transcript Figure 17.7 Transcription

  16. Eukaryotic Differences in Transcription

  17. Posttranscriptional Modification • mRNA of eukaryotic cells need to be modified before moving into the cytoplasm • primary transcript – initial eukaryotic mRNA transcript, before modification • 5’ cap – 7-methylguanosine triphosphate • poly-A tail – approx. 200 adenine ribonucleotides are added at the end • modifications prevent cellular enzymes from breaking down mRNA before it is translated into protein

  18. Transcript Modification primary transcript 5’ 3’ 5’ cap added by capping enzyme complex mG 3’ poly-A tail added by poly-A polymerase mG AAAAAAA

  19. 5’ cap

  20. Modifications: Introns / Exons • eukaryotic genes are longer than prokaryotic genes • we carry extra “junk” DNA • most of this “junk” DNA signals when and how often genes should be transcribed  regulatory DNA • primary transcript is longer than necessary • exons– RNA sequences that will be expressed; helps makes the protein • introns– interfering RNA sequences; need to be removed before translation

  21. Transcript Modification intron exon intron exon intron exon intron mG AAAAAAA introns removed by spliceosome proteins exon exon exon mG mRNA transcript AAAAAAA

  22. 3 1 2 RNA transcript (pre-mRNA) 5 Intron Exon 1 Exon 2 Protein Other proteins snRNA snRNPs Spliceosome 5 Spliceosome components Cut-out intron mRNA 5 Exon 1 Exon 2 Spliceosome Complex Spliceosomes are a series of small nuclear ribonucleoproteins (snRNP) that work together to remove introns. snRNPs recognize specific sequences on the introns • cuts out intron sequences • splices exon sequences together

  23. Classwork/Homework • Section 5.3 – pg. 249 #1-5, 7-9

More Related
SlideServe
Audio
Live Player
Audio Wave
Play slide audio to activate visualizer