1 / 37

1. The information carried by a DNA molecule is in A. Its amino acid sequence

D.N.A Objective: SWBAT describe the process of transcription and translation IOT understand how proteins are created. 1. The information carried by a DNA molecule is in A. Its amino acid sequence B. The sugars and phosphates forming its backbone

stephanie-gutierrez
Télécharger la présentation

1. The information carried by a DNA molecule is in A. Its amino acid sequence

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. D.N.AObjective: SWBAT describe the process of transcription and translation IOT understand how proteins are created 1. The information carried by a DNA molecule is in A. Its amino acid sequence B. The sugars and phosphates forming its backbone C. The order of the bases in the molecule D. The total number of nucleotides it contains E. The RNA units that make up a molecule • DNA replication occurs A. Whenever a cell makes protein B. To repair gene damage caused by mutation C. Before a cell divides D. Whenever a cell needs RNA E. In the cytoplasm of a eukaryotic cell 3. The complementary strand of DNA to the DNA fragment 5’- GGC ATA CAT – 3” is A . 3’ – CCG UAU GUA – 5’ B. 3’ – GTA TAT CCG -5’ C. 3’ – ATG TAT GCC – 5’ D. 3’ – CCG TAT GTA – 5’ E. 3’ – CCG AUA GUA – 5’

  2. From Gene to Protein How Genes Work

  3. What do genes code for? • How does DNA code for cells & bodies? • how are cells and bodies made from the instructions in DNA DNA proteins cells bodies

  4. The “Central Dogma” • Flow of genetic information in a cell • How do we move information from DNA to proteins? transcription translation RNA DNA protein trait DNA gets all the glory, but proteins do all the work! replication

  5. A B C D E disease disease disease disease Metabolism taught us about genes • Inheritance of metabolic diseases • suggested that genes coded for enzymes • each disease (phenotype) is caused by non-functional gene product • lack of an enzyme • Tay sachs • PKU (phenylketonuria) • albinism Am I just the sum of my proteins? metabolic pathway     enzyme 1 enzyme 2 enzyme 3 enzyme 4

  6. Transcription fromDNA nucleic acid languagetoRNA nucleic acid language

  7. Transcription • Transcription is the synthesis of messenger RNA (mRNA) from DNA • Occurs in the nucleus • DNA does not leave the nucleus • Analogy: blueprints do not get used at the job site when constructing a house

  8. DNA vs. RNA

  9. Transcription • Making mRNA • transcribed DNA strand = template strand • enzyme • RNA polymerase coding strand 3 A G C A T C G T 5 A G A A A C G T T T T C A T C G A C T DNA 3 C T G A A 5 T G G C A U C G U T C unwinding 3 G T A G C A rewinding mRNA template strand RNA polymerase 5 build RNA 53

  10. Transcription: Initiation • Promoter = a specific sequence of DNA (starting point) • RNA polymerase binds to the promoter on the DNA molecule • Transcription factors (proteins) bind to promoter region to help RNA polymerase find the starting point. • RNA polymerase then separates the 2 DNA strands

  11. Transcription: Elongation • As RNA polymerase moves along the DNA, it untwists the double helix and separates the strands • RNA polymerase adds nucleotides to the 3’ end of the mRNA molecule • Follows the base-pairing rules G = C A = U

  12. RNA polymerase Matching bases of DNA & RNA A C U G A • Match RNA bases to DNA bases on one of the DNA strands G G U C U U G C A C A U A G A C U A 5' 3' G C C A T G G T A C A G C T A G T C A T C G T A C C G T

  13. Transcription: Termination • Termination signal = sequence of bases in DNA molecule that tell RNA polymerase to stop transcription • “finish line” in a race • mRNA is released from the DNA

  14. RNA Modifications • In eukaryotes, mRNA is edited before it’s sent out of the nucleus • 2 major types of modifications: • Alteration of mRNA ends • RNA splicing

  15. RNA Splicing • Genes have stretches of nucleotides that don’t code for anything • “junk DNA” • Noncoding sequence = introns • “intervening sequences” • Coding regions = exons • During RNA splicing, the introns are removed by enzymes and the exons are joined together

  16. 3' poly-A tail 3' A A A A A mRNA 50-250 A’s 5' cap P P P 5' G Alteration of mRNA Ends • Need to protect mRNA on its trip from nucleus to cytoplasm • enzymes in cytoplasm attack mRNA • protect the ends of the molecule • add 5 cap • add poly-A tail • longer tail, mRNA lasts longer: produces more protein

  17. Translation fromnucleic acid languagetoamino acid language

  18. TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla protein ? How does mRNA code for proteins? ATCG AUCG

  19. TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA codon MetArgValAsnAlaCysAla protein ? mRNA codes for proteins in triplets

  20. Cracking the code 1960 | 1968 Nirenberg & Khorana • Crick • determined 3-letter (triplet) codon system WHYDIDTHEREDBATEATTHEFATRAT WHYDIDTHEREDBATEATTHEFATRAT • Nirenberg (47) & Khorana (17) • determined mRNA–amino acid match • added fabricated mRNA to test tube of ribosomes, tRNA & amino acids • created artificial UUUUU… mRNA • found that UUU coded for phenylalanine

  21. The code • Code for ALL life! • strongest support for a common origin for all life • Code is redundant • several codons for each amino acid • 3rd base wobble • Start codon • AUG • methionine • Stop codons • UGA, UAA, UAG

  22. GCA UAC CAU Met Arg Val How are the codons matched to amino acids? 3 5 TACGCACATTTACGTACGCGG DNA 5 3 AUGCGUGUAAAUGCAUGCGCC mRNA codon 3 5 tRNA anti-codon aminoacid

  23. aa aa aa aa aa ribosome aa aa aa aa aa aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein trait

  24. GCG Alanine UCA Serine CUG Leucine

  25. aa aa aa aa aa ribosome aa aa aa aa aa aa From gene to protein nucleus cytoplasm transcription translation DNA mRNA protein trait

  26. GCA UAC CAU Met Arg Val How are the codons matched to amino acids? 3 5 TACGCACATTTACGTACGCGG DNA 5 3 AUGCGUGUAAAUGCAUGCGCC mRNA codon 3 5 tRNA anti-codon aminoacid

  27. Transfer RNA structure • “Clover leaf” structure • anticodon on “clover leaf” end • amino acid attached on 3 end

  28. Loading tRNA • Aminoacyl tRNA synthetase • enzyme which bonds amino acid to tRNA • bond requires energy • ATP  AMP • bond is unstable • so it can release amino acid at ribosome easily Trp C=O Trp Trp C=O H2O OH O OH C=O O activating enzyme tRNATrp A C C mRNA U G G anticodon tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA

  29. Ribosomes • Facilitate coupling of tRNA anticodon to mRNA codon • organelle or enzyme? • Structure • ribosomal RNA (rRNA) & proteins • 2 subunits • large • small E P A

  30. Ribosomes • A site (aminoacyl-tRNA site) • holds tRNA carrying next amino acid to be added to chain • P site (peptidyl-tRNA site) • holds tRNA carrying growing polypeptide chain • E site (exit site) • empty tRNA leaves ribosome from exit site Met C A U 5' G U A 3' E P A

  31. 3 2 1 Building a polypeptide • Initiation • brings together mRNA, ribosome subunits, initiator tRNA • Elongation • adding amino acids based on codon sequence • Termination • end codon release factor Leu Val Ser Met Met Ala Leu Met Met Leu Leu Trp tRNA C A G C G A C C C A A G A G C U A C C A U A U U A U G A A 5' 5' A A 5' C U U 5' A A G G A G U U G U C U U U G C A C U 3' G G U A A U A A C C mRNA 3' 3' 3' U G G U A A 3' E P A

  32. Protein targeting • Destinations: • secretion • nucleus • mitochondria • chloroplasts • cell membrane • cytoplasm • etc… • Signal peptide • address label start of a secretory pathway

  33. RNA polymerase DNA Can you tell the story? aminoacids exon intron tRNA pre-mRNA 5' GTP cap mature mRNA aminoacyl tRNAsynthetase poly-A tail 3' large ribosomal subunit polypeptide 5' tRNA small ribosomal subunit E P A ribosome

  34. Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons intron = noncoding (inbetween) sequence exon = coding (expressed) sequence Prokaryote vs. Eukaryote genes intronscome out! eukaryotic DNA

  35. Translation in Prokaryotes • Transcription & translation are simultaneous in bacteria • DNA is in cytoplasm • no mRNA editing • ribosomesread mRNA as it is being transcribed

  36. Translation: prokaryotes vs. eukaryotes • Differences between prokaryotes & eukaryotes • time & physical separation between processes • takes eukaryote ~1 hour from DNA to protein • no RNA processing

More Related