280 likes | 296 Vues
Lecture 2: Foundations of Genetic Variation. August 24, 2012. Overview. Review of genetic variation and Mendelian Genetics Methods for detecting variation Estimating allele frequencies. Mutation. Drift. +. -. +. +/-. Selection. Migration. Population Genetics.
E N D
Lecture 2: Foundations of Genetic Variation August 24, 2012
Overview • Review of genetic variation and Mendelian Genetics • Methods for detecting variation • Estimating allele frequencies
Mutation Drift + - + +/- Selection Migration Population Genetics Study of heritable variation in assemblages of organisms, and how this is affected by mutation, drift, selection, and gene flow Diversity
What is Genetic Variation? • Chromosome: structural unit of genetic material, containing DNA and protein • Homologous: genetic material that pairs during meiosis in diploid cells • Diploid: two sets of homologous chromosomes (one from each parent) • Haploid: one set of chromosomes (the Genome) • Locus: position on a chromosome • Allele: different forms of the same locus
Organelle Genomes • Mitochondria (most Eukaryotes) and chloroplasts (most plants) are ancient endosymbionts • Maintain their own genomes, but with greatly reduced numbers of genes: dependent on imports from nucleus • Mostly maternally inherited and haploid: no recombination
Phenotypes versus Genotypes http://en.wikipedia.org/wiki/ • Phenotype: Any observable characteristic of an organism • External morphology: height, weight, color • Physiology: Metabolic rate, photosynthetic rate, salt sensitivity • Biochemical: Enzymatic rates, chemical composition • Genotype: The hereditary or genetic constitution of an individual
Why can’t you directly infer the genotype from the phenotype? Why can’t you directly infer the phenotype from the genotype?
Genetics vs Environment • Many advances made in evolutionary theory based on morphology • Problem was variation could be exaggerated • Only variable 'loci' scored • Phenotype vs Genotype Var(phenotype) = Var(genotype) + Var(environment) Heritability: Var(genotype) / Var(phenotype) • Phenotypic plasticity: organisms with the same genotype have different phenotypes under different conditions • Solution: control environmental variance by raising organisms in common environment
Early Models of Inheritance Lamarck: inheritance of acquired characteristics http://en.wikipedia.org/ 1744-1829 • Developed first fully coherent evolutionary theory • A “complexifying force” drives organisms to higher levels of complexity • Use and disuse of organs affects their development and inheritance http://morriscourse.com
Early Models of Inheritance Blending Inheritance • Offspring have phenotypes that are intermediate between that of their parents • Originally explored by Francis Galton and favored by the “biometricians” such as Pearson and Weldon • Darwin thought this worked against evolution http://en.wikipedia.org/ 1857-1936 Hamilton 2009
Early Models of Inheritance Darwin’s Theory: Pangenesis • Explains variation among individuals, gradual evolutionary change in response to selection • Hereditary material consists of “gemmules” distributed throughout body that accumulate in reproductive organs • Elements of Lamarckian inheritance http://en.wikipedia.org/ 1809-1882
Early Models of Inheritance Discontinuous Variation • Darwin’s cousin Galton performed experiments to disprove pangenesis • “Sports” or mutations with large effects were considered key drivers of evolution by Francis Galton, William Bateson and others http://en.wikipedia.org/ 1822-1911
Mendel and Particulate Inheritance • Gregor Mendel conducted a large number of experiments with peas and other plants in the Augustinian Abbey of St Thomas in Brno between 1857 and 1863 • Studied over 29,000 pea plants to determine how traits were inherited • Why peas? Self-fertile, little or no outcrossing • Bred pure lines and then intercrossed them and followed advanced generations http://www.schoolnotes.com/32233/tss8.html schoolnotes.com
Mendel’s Observations: F1 and F2 • Pure bred lines will produce only one phenotype at F1 when intercrossed • F2 generation has a 3:1 ratio of dominant:recessive phenotypes Hamilton 2009
Two Types of F2s When F2’s are selfed, some breed true and some of the dominant phenotype produce 3:1 ratios of offspring phenotypes
Mendel’s “Law” of Independent Segregation • Based on analyzing simply inherited traits • During gamete formation, two members of a gene pair (alleles) segregate separately so that half of the gametes carry one allele and half carry the other
Mendel’s “Law” of Independent Assortment • Based on analyzing ratios of two traits segregating simultaneously • During gamete formation, the segregation of alleles of one gene is independent of the segregation of alleles of another gene
Mendel’s “Laws” of Independent Segregation and Assortment • Phenotype Ratio: (3:1) x (3:1) = 9:3:3:1 • Genotype Ratio: (1:2:1) x (1:2:1) = 1:2:1:2:4:2:1:2:1 AABB:AABb:AAbb:AaBB:AaBb:Aabb:aaBB:aaBb:aabb
Morphological Markers • Traditionally used to measure genetic variation • Mendel’s Laws derived from simply-inherited morphological markers in peas: genotype directly inferred from phenotype • Genetic maps originally constructed from such characteristics (e.g., corn genetic map at right)
Lactate Dehydrogenase Dym et al 2000: PNAS 97:9413–9418 Isozymes and Allozymes • Mutations can cause differences in basic and acidic amino acid composition, but no change in enzyme function • Small changes in primary structure can alter secondary and quaternary structure • Isozymes: different forms of an enzyme • Allozymes: Allelic isozymes: different forms of an enzyme that are coded at the same locus
Hillis, D.M., C. Moritz and B. K. Mable. 1996. Molecular Systematics, 2nd ed. Sinauer Assoc. Inc., Sunderland, Mass Detection • Separate through electrophoresis in starch gels • Isozymes dected based on enzyme action • Stain contains substrate for enzyme, cofactors, and oxidized salt (dye) • Resulting pattern is zymogram • Often a direct link between phenotype (spots on gel) and genotype (genes encoding the enzyme)
Richard Lewontin http://www.patentdocs.us/patent_docs/2007/05/the_as_yet_unfu.html Allozymes revolutionized population genetics • Landmark 1966 papers by Lewontin and Hubby • Simple and unbiased way of detecting genetic variation • Explosion of studies of genetic variation in natural populations • Levels of diversity in natural populations MUCH higher than predicted by prevailing theory at the time • Role of selection not most important factor determining genetic diversity: Neutral Theory
PCR and the Molecular Revolution • PCR: Polymerase Chain Reaction • Invented by Kary Mullis in 1983 • Exponential amplification of a specific sequence of DNA • Most important molecular marker techniques involve PCR • Components: primers, nucleotides, template, thermostable polymerase • http://www.dnalc.org/ddnalc/resources/pcr.html
Molecular Markers • Molecular markers provide closer link between phenotype and genotype • “Anonymous” molecular markers: RFLP, RAPD, AFLP and GBS: no knowledge of underlying sequence polymorphism or location in genome • “Sequence-Tagged” markers like microsatellites derived from defined locations in genome • Often reveal higher levels of polymorphism than allozymes and morphological markers • Allow studies of neutral variation in natural populations
Anonymous and Sequence-Tagged Markers • Anonymous markers often have short “primer” sequences (e.g., 10 bp primer sequences in RAPD) • Randomly amplify portions of genome • Sequence-Tagged markers have longer primers (e.g., 20 bp for microsatellite primers) TCAAGTCTCA AGTTCAGAGT agctggactacctctacgtcagcTGAGACTTGA ACTCTGAACT ATGCTGAGGTCGCTTAGCAGctctctctctctctctctctcctctctctctctctGGATCCTGAATGCTGACTG ATGCTGAGGTCGCTTAGCAGctctctctctctctGGATCCTGAATGCTGACTG
If nucleotides occur randomly in a genome, which sequence should occur more frequently? AGTTCAGAGT AGTTCAGAGTAACTGATGCT What is the expected probability of each sequence to occur once? How many times would each sequence be expected to occur by chance in a 100 Mb genome?
What is the expected probability of each sequence to occur once? AGTTCAGAGT What is the sample space for the first position? A T G C Probability of “A” at that position? Probability of “A” at position 1, “G” at position 2, “T” at position 3, etc.? AGTTCAGAGTAACTGATGCT
How many times would each sequence be expected to occur in a 100 Mb genome? AGTTCAGAGT AGTTCAGAGTAACTGATGCT Why is this calculation wrong?