Lesson 4: Classification of Microorganisms
Lesson 4: Classification of Microorganisms. May 29, 2014. Taxonomy. Taxonomy —the science of classifying organisms ( taxa — categories of organisms) Provides a reference for identifying organisms
Lesson 4: Classification of Microorganisms
E N D
Presentation Transcript
Lesson 4: Classification of Microorganisms May 29, 2014
Taxonomy Taxonomy—the science of classifying organisms (taxa—categories of organisms) • Provides a reference for identifying organisms • Carlos Linnaeus introduced a formal system of classification, dividing living organisms into two groups, Plantae and Animalia • Used Latin names to provide a “common” language for all organisms
Systematics or Phylogeny • The study of the evolutionary history of organisms • Phylogeny reflects evolutionary relationships • Details the similarities and differences between bacteria and group common bacteria together • All Species Inventory (2001–2025) • To identify all species of life on Earth • 1.7 million different organisms identified as of 2012 • Estimated that there are over 100 million species
Three Domain Classification • Study of ribosomes allowed scientists to divide cell types into three groups • Remember ALL cells contain ribosomes • rRNA (16S RNA) are different for each group • Eukarya, Bacteria, and Archaea • Bacteria and Archaea are very similar • Bacteria contains peptidoglycan and Archaea do not • Molecular Clock measures evolution in terms of mutations in the nucleotide sequences • rRNA sequences mutate slowly (highly conserved) and provide the most confident results when looking at evolution
Figure 10.1 The Three-Domain System. Eukarya Animals Fungi Origin of mitochondria Bacteria Amebae Origin of chloroplasts Mitochondria Slime molds Archaea Cyanobacteria Plants Ciliates Extreme halophiles Proteobacteria Green algae Chloroplasts Methanogens Dinoflagellates Diatoms Hyperthermophiles Gram-positive bacteria Euglenozoa Thermotoga Giardia Horizontal gene transfer occurred within the community of early cells. Mitochondrion degenerates Nucleoplasm grows larger Vertical Gene Transfer Lateral Gene Transfer
Table 10.1 Some Characteristics of Archaea, Bacteria, and Eukarya
Phylogenetics • Each species retains some characteristics of its ancestor • Grouping organisms according to common properties implies that a group of organisms evolved from a common ancestor • Anatomy • Metabolic Processes • rRNA
Scientific Nomenclature • Common names • Vary with languages and with geography • Creates ambiguity
Name This Organism • Cellar Spiders • Daddy Longlegs • Pholcidae
Scientific Nomenclature • Common names • Vary with languages and with geography • Creates ambiguity • Incorrectly identifies the organism
Name This Organism • Tillandsiausneiodes
Scientific Nomenclature • Binomial nomenclature (genus + specific epithet) • Used and understood worldwide • Genus capitalized and species lowercase • Escherichia coli, Pseudomonas aeruginosa, and Homo sapiens
Taxonomic Hierarchy 1. Domain 2. Kingdom 3. Phylum 4. Class 5. Order 6. Family 7. Genus 8. Species
Figure 10.5 The taxonomic hierarchy. All organisms Eukarya Archaea Bacteria Domain Fungi None assigned for bacteria None assigned for archaea Kingdom Ascomycota Euryarcheota Proteobacteria Phylum Hemiascomycetes Methanococci Gammaproteobacteria Class Enterobacteriales Saccharomycetales Methanococcales Order Enterobacteriaceae Saccharomycetaceae Methanococcaceae Family Methanothermococcus Saccharomyces Escherichia Genus S. cerevisiae M. okinawensis E. coli Species E. coli Baker’s yeast Methanococcus
Critical Thinking • When writing the genus and species for the first time in a paper the FULL genus must be used. Why? • Escherichia coli and Entamoeba coli
Classification of Prokaryotes • Prokaryotic species: a population of cells with similar characteristics • Bacteria grown in the lab is categorized into: • Culture: grown in laboratory media • Clone: population of cells derived from a single cell • All cells in a clone SHOULD be identical but mutations may occur • Strain: genetically different cells within a clone • Usually denoted by numbers, letters, or names that follow the specific epithet • E. coli O104:H4 (PATHOGENIC) VS. E. coli K12 (non-pathogenic)
Classification of Eukaryotes • Eukaryotic species: a group of closely related organisms that breed among themselves • Categorized based on unicellular (Protista and some Fungi) or multi-cellular (Animalia, Plantae, and some Fungi) • Protists—unicellular or multicellular eukaryotic organisms lacking specialized tissues • Trypanasomabrucei(African-sleeping sickness), Plasmodium spp. (Malaria), Algae • Classified into clades
Characteristics of Classifications • Animalia: multi-cellular; no cell walls; chemoheterotrophic • Plantae: multi-cellular; cellulose cell walls; usually photoautotrophic • Fungi: chemoheterotrophic; unicellular or multicellular; cell walls of chitin; develop from spores or hyphal fragments • Protista: a catchall kingdom for eukaryotic organisms that do not fit other kingdoms • Grouped into clades based on rRNA
Classification of Viruses • VIRUSES ARE NOT ALIVE! • Are not comprised of cells • Require a host to live and reproduce (obligate intracellular parasites) • Viral species: population of viruses with similar characteristics that occupies a particular ecological niche
Classification and IdentificationMicroorganisms • Classification: placing organisms in groups of related species • Lists of characteristics of known organisms • Identification: matching characteristics of an “unknown” organism to lists of known organisms • Clinical lab identification • Microorganisms are identified for practical purposes such as determining treatment for infection
Clinical Identification Methods • Morphological characteristics: Size and shape • Not particularly useful for bacteria • Differential staining: Simple and Gram staining, acid-fast staining • Based on cell membrane differences • Biochemical tests: determines presence of bacterial enzymes • Catalases, peroxidases, agglutination tests, fermentation tests, etc.
Figure 6.10 Differential medium. Uninoculated Staphylococcus epidermis Staphylococcus aureus MANNITOL SALT AGAR PLATE
Figure 10.9 One type of rapid identification method for bacteria: Enterotube II from Becton Dickinson. One tube containing media for 15 biochemical tests is inoculated with an unknown enteric bacterium. After incubation, the tube is observed for results. Phenylalanine Adonitol Arabinose Ornithine Lactose Sorbitol Glucose Dulcitol Lysine Urease Citrate Indole V–P H2S Gas The value for each positive test is circled, and the numbers from each group of tests are added to give the ID value. 2 + 1 4 + 2 + 1 4 + 2 + 1 4 + 2 + 1 4 + 2 + 1 2 1 0 0 7 Comparing the resultant ID value with a computerized listing shows that the organism in the tube is Proteus mirabilis. Atypical Test Results Confirmatory Test ID Value Organism Ornithine– Sucrose 21006 Proteus mirabilis 21007 Proteus mirabilis Ornithine– Salmonella choleraesuis Lysine– 21020
Applications of Microbiology 10.1b Mass Deaths of Marine Mammals Spur Veterinary Microbiology Gram reaction? – + Oxidase? Morphology Yes No Rods Cocci Staphylococcus aureus Urea hydrolyzed? Citrate utilized? Erysipelothrix rhusiopathiae Yes Yes No No Yersinia enterocolitica Klebsiella pneumoniae Bordetella bronchiseptica Indole produced? Yes No Mannheimia haemolytica Acetoin produced? (V-P test) No Yes Aeromonas hydrophila Pasteurella multocida
Figure 10.7 A clinical microbiology lab report form. x x vag. Filled out by different person Filled out by one person
Serology • Serology is the science that studies serum and immune responses that are evident in serum (does not contain blood cell or clotting factors) • Combine known anti-serum plus unknown bacterium • Rabbit immune system injected with pathogen produces antibodies against that pathogen • Strains of bacteria with different antigens are called serotypes, serovars, biovars • Slide agglutination test
Figure 10.10 A slide agglutination test. Positive test Negative test
ELISA • Enzyme-linked immunosorbent assay • Known antibodies • Unknown type of bacterium • Antibodies linked to enzyme • Enzyme substrate
Figure 18.14.4 The ELISA method. Enzyme's substrate ( ) is added, and reaction produces a product that causes a visible color change ( ). Enzyme's substrate ( ) is added, and reaction produces a product that causes a visible color change ( ). 4 4 (a) A positive direct ELISA to detect antigens (b) A positive indirect ELISA to detect antibodies
Figure 10.11 An ELISA test. (a) A technician uses a micropipette to add samples to a microplate for an ELISA. (b) ELISA results are then read by the computer scanner.
Figure 10.12 The Western blot. If Lyme disease is suspected in a patient: Electrophoresis is used to separate Borrelia burgdorferi proteins in the serum. Proteins move at different rates based on their charge and size when the gel is exposed to an electric current. Lysed bacteria Polyacrylamide gel Proteins Larger Paper towels Smaller The bands are transferred to a nitrocellulose filter by blotting. Each band consists of many molecules of a particular protein (antigen). The bands are not visible at this point. Sponge Salt solution Gel Nitrocellulose filter The proteins (antigens) are positioned on the filter exactly as they were on the gel. The filter is then washed with patient’s serum followed by anti-human antibodies tagged with an enzyme. The patient antibodies that combine with their specific antigen are visible (shown here in red) when the enzyme’s substrate is added. The test is read. If the tagged antibodies stick to the filter, evidence of the presence of the microorganism in question—in this case, B. burgdorferi—has been found in the patient’s serum.
Figure 10.13 Phage typing of a strain of Salmonella enterica. Bacteriophages are viruses that infect bacteria
Flow Cytometry • Utilizes lasers to analyze the physical and chemical properties of a cell • Can be used in • Cell counting • Cell sorting • Biomarker detection (fluorescent dyes) • Cells selectively stained with antibody plus fluorescent dye
Genetics • DNA fingerprinting • Electrophoresis of restriction enzyme digests • rRNAsequencing • Polymerase chain reaction (PCR)
Figure 10.14 DNA fingerprints. 1 2 3 4 5 6 7
BLAST Analysis • GAAGTTTGTTTTGTTTGTAGGCAAACTTATCTCTTTGAATCCGAGCTGTTTATTATTTTATTTTGTTTGCTTTGATTTGCTAATTACCTGTTATTAGACGATTTGTTTTAAAAAACAATTGATATAATTTTTATTTTATATGTAATATTGTCTATGAGGGCTAGTTTCT • http://blast.ncbi.nlm.nih.gov/Blast.cgi
PCRDNA Amplification Requires DNA Template Primers Nucleotides Taq polymerase
Figure 10.15 DNA-DNA hybridization. Organism A DNA Organism B DNA 1 2 3 4 Heat to separate strands. Combine single strands of DNA. Cool to allow renaturation of double-stranded DNA. Determine degree of hybridization. Partial hybridization: organisms related Complete hybridization: organisms identical No hybridization: organisms unrelated
Figure 10.16 A DNA probe used to identify bacteria. Plasmid 3 7 2 1 4 5 6 Salmonella DNA fragment Unknown bacteria are collected on a filter. A Salmonella DNA fragment is cloned in E. coli. The cells are lysed, and the DNA is released. Cloned DNA fragments are marked with fluorescent dye and separated into single strands, forming DNA probes. The DNA is separated into single strands. DNA probes are added to the DNA from the unknown bacteria. Fluorescent probe Salmonella DNA DNA probes hybridize with Salmonella DNA from sample. Then excess probe is washed off. Fluorescence indicates presence of Salmonella. DNA from other bacteria
Figure 10.17ab DNA chip. (a) A DNA chip can be manufactured to contain hundreds of thousands of synthetic single-stranded DNA sequences. Assume that each DNA sequence was unique to a different gene. (b) Unknown DNA from a sample is separated into single strands, enzymatically cut, and labeled with a fluorescent dye.
FISH • Fluorescent in situ hybridization • Used to identify specific sequences in DNA/Chromosomes • Add DNA probe for S. aureus
Critical Thinking • What is tested in Western blotting and Southern blotting? • What is identified by phage typing? • How does PCR identify a microbe? • Which techniques involve nucleic acid hybridization?