Keystone Exam Content Review
Keystone Exam Content Review. Chapter 13: RNA and Protein Synthesis. Chapter 13 Keystone Terms. Chromosomal Mutation, 372 Frame-Shift Mutation, 373 Gene Expression, 370 Mutation, 372 Point Mutation, 373 Protein Synthesis Transcription, 364 Translation, 368 Translocation, 374. RNA.
Keystone Exam Content Review
E N D
Presentation Transcript
Chapter 13 Keystone Terms • Chromosomal Mutation, 372 • Frame-Shift Mutation, 373 • Gene Expression, 370 • Mutation, 372 • Point Mutation, 373 • Protein Synthesis • Transcription, 364 • Translation, 368 • Translocation, 374
RNA Consists of a long chain of nucleotides (like DNA) with each nucleotide having a 5-carbon sugar, phosphate group, and nitrogenous base THREE main differences between RNA and DNA: • Sugar in RNA is ribose instead of deoxyribose • RNA is generally single-stranded • RNA contains uracil in place of thymine
Types of RNA Messenger RNA(mRNA)carries copies of instructions for assembling amino acids into proteins Ribosomal RNA (rRNA) along with several proteins make up ribosomes Transfer RNA(tRNA) transfers each amino acid to the ribosome as specified by coded messages in the mRNA
Transcription 1) RNA Polymerase binds to DNA at a PROMOTER (region of DNA that tells RNA Polymerase where to bind and make RNA) and separates the strands 2) One strand of DNA is used as a template by RNA Polymerase 3) Complementary nucleotides are added and assembled into a strand of mRNA *REMEMBER: the mRNA is SINGLE-stranded and has URACIL as a complementary base instead of thymine!!
Transcription Practice The genetic sequence of a strand of DNA is as follows: GCTTAGGGCCAGTATAGCAATC What is the complementary strand of mRNA? CGAAUCCCGGUCAUAUCGUUAG
RNA Editing INTRONS regions NOT involved in coding for proteins EXONS DNA sequences that code for proteins Introns are cut out and exons put together to make mRNA… WHY DOES THIS HAPPEN?
The Genetic Code Proteins are made by joining amino acids into long chains called POLYPEPTIDES, which are combinations of the 20 amino acids (order of A.A. determines properties of a protein) Code is determined by the order of the mRNA bases! FOUR letters (A, U, G, and C) have instructions for 20 A.A. CODON consists of THREE consecutive nucleotides on mRNA that specify a particular amino acid
The Genetic Code There are 64 possible three-base codons and since there are only 20 A.A., some A.A. are specified by more than one codon! AUG = codes for methionine or “START” codon UAA, UAG, and UGA = codes for “STOP” codon
The Genetic Code REMEMBER to use mRNA sequence when decoding!!!! Start in the middle and work outward!
Translation 1) Messenger RNA is transcribed in the nucleus, and then enters the cytoplasm where it attaches to a ribosome (translation has now started)
Translation 2) Start codon (AUG) tells process to start and the ribosome starts “reading” the mRNA one codon at a time… proper amino acids are brought to ribosome by tRNA Each tRNA carries only ONE amino acid, has THREE unpaired bases, known as an ANTICODON, which are complementary to the mRNA sequence!
Translation 3) Ribosome binds new tRNAmolecules and A.A. as mRNA moves along Lysine Phenylalanine tRNA Methionine mRNA Start codon
Translation 4) Peptide bond is formed between the first two A.A. (join together) and tRNA bonds to A.A. and mRNA are broken. The tRNA floats away, allowing more tRNA to bond and PROTEIN SYNTHESIS continues
Translation 5) Process continues until a “stop” codon is reached, generating a new polypeptide or PROTEIN
Roles of DNA and RNA Stays in nucleus Genes code for PROTEINS which are enzymes that can catalyze or regulate reactions… Proteins build or operate different things in cells!! (Ex: enzyme produces pigment for flower, red blood cell surface protein determines blood type, etc.) Leaves nucleus and goes to ribosome Building occurs at the ribosome
Mutations Accidental changes in genetic material TWO TYPES Gene and Chromosomal • GENE • POINT Mutations changes in one or few nucleotides • FRAMESHIFT Mutations changes that shift the “reading frame” of the code (BAD!)
Types of Mutations SUBSTITUTIONS usually affect no more than a single amino acid
Types of Mutations For INSERTIONS, an extra base is added into a base sequence (more drastic!)
Types of Mutations In a DELETION, a single base is deleted and the reading frame is shifted (more drastic!)
Mutations • CHROMOSOMAL (include deletions, duplications, inversions, or translocations)
Mutations • CHROMOSOMAL (include deletions, duplications, inversions, or translocations)
Mutations • CHROMOSOMAL (include deletions, duplications, inversions, or translocations)
Mutations • CHROMOSOMAL (include deletions, duplications, inversions, or translocations)
12-4 Mutations Mutations • CHROMOSOMAL (include deletions, duplications, inversions, or translocations)
Significance of Mutations • Most are NEUTRAL, meaning little or no effect on gene expression or proteins • Some cause MAJOR changes in protein structure, producing defective proteins that disrupt normal function (diseases, etc.) • BENEFICIAL Source of genetic variation (can be useful)
Chapter 14 Keystone Terms • Nondisjunction, 401 • Sex-Linked Trait, 395
Human Chromosomes • Two of the chromosomes are known as SEX CHROMOSOMES or GAMETES because they determine the sex of the individual: • XX = Female • XY = Male • Remaining chromosomes are AUTOSOMES
How Is Sex Determined? 50 / 50 CHANCE! All human eggs cells carry a single X chromosome, while half of the sperm cells carry an X and the other half carry a Y chromosome!
Sex-Linked Traits Genes located on the sex chromosomes Y chromosome is much smaller than the X chromosome and appears to contain only a few genes! Why are SEX-LINKED disorders more common in males than females?
Sex-Linked Cross Similar to other crosses we have done… just remember that the SEX of the individual is important and that males only need ONE recessive allele to have a trait!
Sex-Linked Cross Two important genes on the X chromosome help control blood clotting. A person who has HEMOPHILIA is lacking a protein necessary for normal blood clotting. About 1 : 10,000 males is born with the disease and this can be treated with protein injections. People with this disease can bleed to death from minor cuts or may suffer internal bleeding! Cross a carrier mother with a man who has hemophilia. What are the chances of having a daughter with the disease? In the U.S., one out of 3,000 males is born with Duchenne Muscular Dystrophy, a disorder that results in the weakening and loss of skeletal muscle. This is caused by a defective muscle protein. Cross a normal male with a carrier female. What are the chances that the couple will have a child with the disease? What are the chances that dad will give the disease to a son?
Common Human Disorders • HUMAN GENOME PROJECT Goal was to map the entire sequence of human genes… completed in 2003!
Common Human Disorders CYSTIC FIBROSIS Normal CFTR allows Cl- ions to pass… In CF, CFTR folded wrong and does not get put in membrane Cells cannot transport Cl- ions, airways clogged with mucus Missing three bases… Phenylalanine is missing
Common Human Disorders SICKLE CELL • Characterized by bent and twisted shape of red blood cells • In normal cells, HEMOGLOBIN is the protein that carries oxygen • In sickle cell, one base is changed, causing abnormal hemoglobin… during low levels of oxygen, some RBC become sickle shaped and can stick together!
Common Human Disorders • NONDISJUNCTION Failure of homologous chromosomes to separate during meiosis (abnormal #s of chromosomes can result) • EXAMPLES • -Down Syndrome (three copies of chromosome 21) aka “Trisomy 21” • -Turner’s Syndrome (only one X chromosome) Sterile • -Klinefelter’s Syndrome (extra X in males, XXY) Sterile
Chapter 15 Keystone Terms • Biotechnology • Cloning, 427 • Forensics, 433 • Gene Splicing • Gene Therapy, 431 • Genetic Engineering, 418 • Genetically Modified Organism • Selective Breeding, 418
What is Genetic Engineering? • Genetic engineering is when a scientist manipulates DNA in a living organism, thus creating a genetically modified organism. Gene Splicing Recombinant DNA Biotechnology is the use of a biological or living organism to develop or modify a product or process for a specific use.
Selective Breeding • Humans use selective breeding, which takes advantage of naturally occurring genetic variation, to pass wanted traits on to the next generation of organism. How does this occur? Labradoodle Chiweenie Puggle
Hybridization and Inbreeding • Hybridization – crossing dissimilar individuals to bring together the best of both organisms. • Inbreeding – continued breeding of individuals with similar characteristics. Why can inbreeding be risky?
Plasmids • Plasmids are circular pieces of DNA found in bacteria that are commonly used in recombinant DNA studies.
Cloning Cloning uses a single cell from an adult organism to grow an entirely new individual that is genetically identical to the organism from which the cell was taken.
Applying Genetic Engineering • How and why is genetic engineering useful? - GM foods (crops and livestock) - Preventing and treating disease - Gene therapy & Genetic testing - DNA Fingerprinting - Forensics
Chapter 16 Keystone Terms • Analogous Structure, 469 • Evolution, 450 • Fossils, 540 • Homologous Structure, 468 • Natural Selection, 460 • Vestigial Structure, 469
Artificial Selection • Members of each species vary from one another • Differences are passed from parents to offspring… Inherited Variation • Artificial Selection:humans select variations they find useful and breed