tynice
Uploaded by
0 SLIDES
135 VUES
0LIKES

DNA Study Guide Key

DESCRIPTION

This study guide summarizes the key research conducted by Frederick Griffith, who injected mice with bacteria to explore the concept of transformation. His experiments revealed that a "transforming principle" from dead bacteria could change the characteristics of live bacteria, leading to the death of mice from pneumonia. The findings highlighted the role of DNA in heredity and pathogen virulence. Make sure to reference the accompanying illustrations for better clarity on Griffith’s observations and conclusions.

1 / 0

Télécharger la présentation

DNA Study Guide Key

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. DNA Study Guide Key

  2. 1.Explain the research of the following scientists: Griffith: injected mice with bacteria. The bacteria caused the transformation that allowed the mice to die of pneumonia. The DNA was transformed. Know the picture from the notes. Avery: discovered DNA and genes. DNA is the transforming factor. Hershey and Chase: they wanted to see what causes a virus. Results-DNA in the virus causes the infection. Franklin and Wilkins: Rosalind Franklin used x-rays to take pictures of the DNA structure. DNA has an X shape. Watson and Crick: credited for the structure of DNA. Discovered that DNA have a double helix structure. Stole Rosalind’s information. Chargaff: Discovered a pattern between the four bases. Guanine = Cytosine and Adenine = Thymine. (ATGrover Cleveland)
  3. What is the role DNA? The role of DNA is to hold genetic material. What is a nucleotide and what are the three parts to it? A nucleotide is the single unit or monomer of a nucleic acid. The three parts are sugar, phosphate group and a nitrogenous base. What two nitrogenous bases are purine? Pyrimidines? Purines = Adenine and Guanine Pyrimidines = Cytosine and Thymine List the steps to DNA replication. Helicase unzips DNA – the two strands become templates – the base pairs come in and bond with complementary strands – The DNA bonds together and they have two strands. What do the following enzymes do during DNA replication? Helicase - unzips DNA DNA polymerase – bonds to a promoter and adds new bases to the template strand.
  4. What are the three differences between RNA and DNA? RNA has ribose and DNA has deoxyribose RNA is single stranded and DNA has two RNA uses Uracil and DNA uses Thymine What are the three types of RNA used during protein synthesis and explain their function? mRNA, tRNA, rRNA mRNA = messenger RNA; makes a copy of the template from DNA (recipe) tRNA= transfer RNA; transfers amino acids to the ribosome rRNA= ribosomal RNA; factory of the protein synthesis, makes up the ribosome. What is a codon and where is it found? A codon is a three letter sequence found in mRNA. What is an anti-codon and where is it found? An anti-codon is the opposite of a codon found on a tRNA molecule. What is transcription? Where does it take place? Transcription = takes place in the nucleus and is the process of DNA coding for RNA. What needs to be added to the mRNA strand before it can leave the nucleus and go to a ribosome in the cytoplasm? mRNA strand needs a cap and tail to leave the nucleus.
  5. What is translation? Where does it take place in the cell? Translation is the process of RNA coding for a protein that takes place on a ribosome in the cytoplasm. Write the mRNA strand for this DNA strand: TACGGCATGAACGTAGCTAGCACT. The mRNA strand is AUGCCGUACUUGCAUCGAUCGUGA What are the amino acids that correspond to the mRNA strand you just made? Codons = AUG-CCG-UAC-UUG-CAU-CGA-UCG-UGA Amino acids = Met-Pro-Tyr-Leu-His-Arg-Ser-STOP
More Related