BLOOD $ URINE COLLECTION
BLOOD $ URINE COLLECTION. Set of blood collection tubes. 1 x 4.5 ml. Citrate vacutainer Citrated plasma. 2 x 9 ml. EDTA vacutainer DNA isolation and EDTA-plasma. 1 x 2 ml. EDTA vacutainer Measurement of HbA1c, hemoglobin and hematocrit. 2 x 9 ml. Heparin vacutainer RNA isolation.
BLOOD $ URINE COLLECTION
E N D
Presentation Transcript
BLOOD $ URINE COLLECTION Set of blood collection tubes 1 x 4.5 ml. Citrate vacutainer Citrated plasma 2 x 9 ml. EDTA vacutainer DNA isolation and EDTA-plasma 1 x 2 ml. EDTA vacutainer Measurement of HbA1c, hemoglobin and hematocrit 2 x 9 ml. Heparin vacutainer RNA isolation Urine collection set 2 x vacutainers, 1 x adaptor Collection of urine 1 x 9 ml. Heparin vacutainer Isolation of Leucocytes and heparin plasma
BLOOD & URINE COLLECTION 1 x 4.5 ml. Citrate vacutainer 1 x 2 ml. EDTA vacutainer 2 x 9 ml. EDTA vacutainer 2 x 9 ml. Heparin vacutainer 1 x 9 ml. Heparin vacutainer 2 x 10 ml. Urine Store in melting ice during transport Store in melting ice during transport Tube A: Freeze within 1 hr. Store in dry-ice during transport Tube B: Add challenger within 1 hr. Store at 37°C during transport Store at room temperature during transport
EDTA: DNA & PLASMA BLOOD HANDLING 2 x 9 ml. EDTA vacutainer Store in melting ice during transport Within 6 hr. Centrifuge: 20 min. 2000 G and 4°C Vacutainer with red cells, buffy- coat and rest plasma Collect plasma in plastic tube Vortex shortly <1 hr RT Store at -20 °C Division of plasma 18 Subsamples of ~500 µl <1 hr RT Snap-freezen Store at <-30 °C Methanol / Dry-ice
Heparine: RNA (rest & challenge) BLOOD HANDLING 2 x 9 ml. Heparine vacutainer TUBEA TUBEB <1 hr RT <1 hr RT Add challenger 3 subsamples of ~ 3 ml Store at 37°C during transport Snap-freezen After 6 hr. (exactly) Methanol / Dry-ice 3 subsamples of ~ 3 ml Store in dry-ice during transport Snap-freezen Methanol / Dry-ice After arrival at TNO Store at<-60 °C Store at<-60 °C
Affymetrix 100K SNP Chips The Sentrix Whole-Genome Genotyping BeadChip 100,000 SNPs 25,000 in transcripts 70,000 within 10kb of exons Array Based Genotyping Costs must reduce further
AGRF Affymetrix Chip GenotypingConcordance and fail rates • Concordance comparison of samples with SNP fail rate of < 3% • Samples tested were an MZ twin pair, plus parents (S3 and S4). • Genomic, Buccal and MDA Genomic replicates were tested for each individual. • Sample MZ 2 Buccal was tested twice. • Fail - no call for one or both samples
Association Analysis • Sharing between unrelated individuals • Disease alleles originate in common ancestor • High resolution • Recombination since common ancestor • Large number of independent tests • Powerful if assumptions are met • Same disease haplotype shared by many patients • Sensitive to population structure
Single Nucleotide Polymorphisms (SNP) GGCTTCAGAATGGCCGGCTTCAAAATGGCC • Single base changes • Human SNPs = 9,856,125 • - Validated SNPs 4,540,241 • Frequency ~ 1 every 400 bp • Can cause functional changes
QIMR’s Sequenom MassARRAY Installation (CCRC-E floor)
* T C * CT * A G * AG * AG Multiplex Analysis
Minimum Finished Genotypes (>99%) Quality of DNA Measure concentrations Dispense in large volumes Quality of Assays Even peak heights Test for Hardy-Weinberg equilibrium Analysis of SNP data is particularly sensitive to assay problems Genotype failures are not random Heterozygous individuals fail most often all SNP typing platforms Error frequency of 0.11% 3268 DNA samples typed twice 159 pairs of MZ twins - No discordant genotypes SNP Genotyping
Whole Genome Association • Use DNA pooling to greatly reduce amount of genotyping • Possible now but reduced power • Use haplotypes to reduce number of SNPs that have to be genotyped • Haplotype blocks – HapMap project • Massive parallel genotyping • Costs must reduce further