vail
Uploaded by
14 SLIDES
632 VUES
180LIKES

BLOOD $ URINE COLLECTION

DESCRIPTION

BLOOD $ URINE COLLECTION. Set of blood collection tubes. 1 x 4.5 ml. Citrate vacutainer Citrated plasma. 2 x 9 ml. EDTA vacutainer DNA isolation and EDTA-plasma. 1 x 2 ml. EDTA vacutainer Measurement of HbA1c, hemoglobin and hematocrit. 2 x 9 ml. Heparin vacutainer RNA isolation.

1 / 14

Télécharger la présentation

BLOOD $ URINE COLLECTION

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. BLOOD $ URINE COLLECTION Set of blood collection tubes 1 x 4.5 ml. Citrate vacutainer Citrated plasma 2 x 9 ml. EDTA vacutainer DNA isolation and EDTA-plasma 1 x 2 ml. EDTA vacutainer Measurement of HbA1c, hemoglobin and hematocrit 2 x 9 ml. Heparin vacutainer RNA isolation Urine collection set 2 x vacutainers, 1 x adaptor Collection of urine 1 x 9 ml. Heparin vacutainer Isolation of Leucocytes and heparin plasma

  2. BLOOD & URINE COLLECTION 1 x 4.5 ml. Citrate vacutainer 1 x 2 ml. EDTA vacutainer 2 x 9 ml. EDTA vacutainer 2 x 9 ml. Heparin vacutainer 1 x 9 ml. Heparin vacutainer 2 x 10 ml. Urine Store in melting ice during transport Store in melting ice during transport Tube A: Freeze within 1 hr. Store in dry-ice during transport Tube B: Add challenger within 1 hr. Store at 37°C during transport Store at room temperature during transport

  3. EDTA: DNA & PLASMA BLOOD HANDLING 2 x 9 ml. EDTA vacutainer Store in melting ice during transport Within 6 hr. Centrifuge: 20 min. 2000 G and 4°C Vacutainer with red cells, buffy- coat and rest plasma Collect plasma in plastic tube Vortex shortly <1 hr RT Store at -20 °C Division of plasma 18 Subsamples of ~500 µl <1 hr RT Snap-freezen Store at <-30 °C Methanol / Dry-ice

  4. Heparine: RNA (rest & challenge) BLOOD HANDLING 2 x 9 ml. Heparine vacutainer TUBEA TUBEB <1 hr RT <1 hr RT Add challenger 3 subsamples of ~ 3 ml Store at 37°C during transport Snap-freezen After 6 hr. (exactly) Methanol / Dry-ice 3 subsamples of ~ 3 ml Store in dry-ice during transport Snap-freezen Methanol / Dry-ice After arrival at TNO Store at<-60 °C Store at<-60 °C

  5. ** Year 2004 to Nov only

  6. Affymetrix 100K SNP Chips The Sentrix Whole-Genome Genotyping BeadChip 100,000 SNPs 25,000 in transcripts 70,000 within 10kb of exons Array Based Genotyping Costs must reduce further

  7. AGRF Affymetrix Chip GenotypingConcordance and fail rates • Concordance comparison of samples with SNP fail rate of < 3% • Samples tested were an MZ twin pair, plus parents (S3 and S4). • Genomic, Buccal and MDA Genomic replicates were tested for each individual. • Sample MZ 2 Buccal was tested twice. • Fail - no call for one or both samples

  8. Association Analysis • Sharing between unrelated individuals • Disease alleles originate in common ancestor • High resolution • Recombination since common ancestor • Large number of independent tests • Powerful if assumptions are met • Same disease haplotype shared by many patients • Sensitive to population structure

  9. Single Nucleotide Polymorphisms (SNP) GGCTTCAGAATGGCCGGCTTCAAAATGGCC • Single base changes • Human SNPs = 9,856,125 • - Validated SNPs 4,540,241 • Frequency ~ 1 every 400 bp • Can cause functional changes

  10. QIMR’s Sequenom MassARRAY Installation (CCRC-E floor)

  11. * T C * CT * A G * AG * AG Multiplex Analysis

  12. Minimum Finished Genotypes (>99%) Quality of DNA Measure concentrations Dispense in large volumes Quality of Assays Even peak heights Test for Hardy-Weinberg equilibrium Analysis of SNP data is particularly sensitive to assay problems Genotype failures are not random Heterozygous individuals fail most often all SNP typing platforms Error frequency of 0.11% 3268 DNA samples typed twice 159 pairs of MZ twins - No discordant genotypes SNP Genotyping

  13. Twelve-Plex Genotyping

  14. Whole Genome Association • Use DNA pooling to greatly reduce amount of genotyping • Possible now but reduced power • Use haplotypes to reduce number of SNPs that have to be genotyped • Haplotype blocks – HapMap project • Massive parallel genotyping • Costs must reduce further

More Related