verna
Uploaded by
26 SLIDES
1237 VUES
430LIKES

High-throughput genotyping

DESCRIPTION

High-throughput genotyping. What is genotyping?. the analysis of DNA-sequence variation genotype = the genetic constitution of an individual. Alleles. alternative form of a gene or DNA sequence at a specific chromosomal location (locus)

1 / 26

Télécharger la présentation

High-throughput genotyping

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. High-throughput genotyping

  2. What is genotyping? • the analysis of DNA-sequence variation • genotype = the genetic constitution of an individual Finnish Genome Center

  3. Alleles • alternative form of a gene or DNA sequence at a specific chromosomal location (locus) • at each locus an individual possesses two alleles, one inherited from the father one from the mother → genotype: a sum of these two alleles Finnish Genome Center

  4. Genetic differences: • may cause or predispose to diseases • determines e.g. individual drug response • used as markers to identify predisposing genes for diseases → high-throughput genotyping technologies needed Finnish Genome Center

  5. Microsatellite markers Di-, tri-, tetranucleotide repeats GAACGTACTCACACACACACACATTTGAC TTCGATGATAGATAGATAGATAGATACGT Finnish Genome Center

  6. ...Microsatellite markers • also called: • STR= Single Tandem Repeat • SSR= Simple Sequence Repeat • SSLP= Simple Sequence Length Polymorphism • the number of repeats varies (→ 30) • highly polymorphic • distributed evenly throughout the genome • easy to detect by PCR Finnish Genome Center

  7. SNP markers • single nucleotide variation GTGGACGTGCTT[G/C]TCGATTTACCTAG Finnish Genome Center

  8. ...SNP markers • The most simple and common type of polymorphism • Highly abundant; every 1000 bp along human genome • Most SNPs do not affect on cell function • some SNPs could predispose people to disease • influence the individual’s response to a drug • Widely used as genetic markers Finnish Genome Center

  9. SNP genotyping methods • over 100 different approaches • Ideal SNP genotyping platform: • high-throughput capacity • simple assay design • robust • affordable price • automated genotype calling • accurate and reliable results Finnish Genome Center

  10. ...SNP genotyping methods • PCR • discrimination between alleles: • allele-specific hybridization • allele-specific primer extension • allele-specific oligonucleotide ligation • allele-specific enzymatic cleavage • detection of the allelic discrimination: • light emitted by the products • mass • change in the electrical property Finnish Genome Center

  11. The Finnish Genome Center • Independent department of University of Helsinki • Since 1998 • National core facility for the genetic research of multifactorial diseases • Provides collaboration and genotyping service to scientist and research groups in Finland, also abroad Finnish Genome Center

  12. The Finnish Genome Center; Goals • help designing genetic studies • perform high-throughput genotyping • perform data analysis • training of scientists • adopt and develop new strategies & technologies Finnish Genome Center

  13. Research strategies • Genome wide scans with microsatellite markers • ~400 dinucleotidemarkers, ~10 cM spacing • Fine mapping • Project specific (microsatellite) markers • SNP genotyping • Primer extension –methods (SNuPe and MassArray; MALDI-TOF), restriction enzyme –methods, project specific markers Finnish Genome Center

  14. Genome Scan • genotyping the whole genome with 400 microsatellite markers at 10 cM interval • look for chromosomal regions with excess allele sharing 0 10 20 30 40 50 60 70 80 90 100 110 120 130 microsatellite markers at 10 cM distance Finnish Genome Center

  15. Fine mapping • candidate regions identified by a genome scan • candidate genes • microsatellite or SNP markers • verification of linkage results Finnish Genome Center

  16. Setting up PCR-reactions Finnish Genome Center

  17. Electrophoresis run Finnish Genome Center

  18. Genotypes Finnish Genome Center

  19. What the data looks like Marker Well ID SampleID Allele1 Allele2 Size1 Size2 D7S513 H01 OA.11616 26 28 190.93 195.02 D7S517 C07 DYS.5020 26 26 262.19 262.19 D7S640 B02 DYS.3819 26 29 133.41 139.41 D7S640 G12 OA.1528 26 29 133.59 139.46 D7S669 E05 OA.11615 26 29 190.37 196.61 D8S258 B06 DYS.5001 26 27 159.38 161.38 D8S260 C02 DYS.3931 26 26 215.57 215.57 D8S264 H01 OA.11616 26 26 158.86 158.86 Finnish Genome Center

  20. SNP genotyping at FGC • PCR-RFLP (restriction fragment length polymorphism) • SNuPe (Single nucleotide primer extension) • MassARRAY; MALDI-TOF (Matrix Assisted Laser Desorption/Ionization Time-of-flight mass spectrometry) Finnish Genome Center

  21. PCR-RFLP • Reactions designed to produce products of different sizes after enzymatic cleavage size in bp Undigested PCR product 243 C analyte 228 Tanalyte 94 Finnish Genome Center

  22. SNuPe • primer extension reactions designed to produce differentially labelled products • analysis by capillary electrophoresis (MegaBACE) labelled nucleotide Extendable primer GGACCTGGAGCCCCCACC - C analyte GGACCTGGAGCCCCCACCC C (blue) Tanalyte GGACCTGGAGCCCCCACCT T (red) Finnish Genome Center

  23. MassARRAY System (MALDI-TOF) • Primer extension reactions designed to generate different sized products • Analysis by mass spectrometry C/T G/A dTTP dGTP ddCTP dATP G/A Mass in Daltons Extendable primer GGACCTGGAGCCCCCACC 5430.5 C analyte GGACCTGGAGCCCCCACCC 5703.7 Tanalyte GGACCTGGAGCCCCCACCTC 5976,9.9 Finnish Genome Center

  24. Mass spectrometry multiplexing Finnish Genome Center

  25. Primer extension mass spectrometry Advantages: • accurate • automated assay design • fast automated data collection • multiplexing capacity Disadvantages: • expensive instruments, consumables • extensive post-PCR processing Finnish Genome Center

  26. SNP genotyping workflow at FGC Finnish Genome Center

More Related