Isaiah 40:28
Isaiah 40:28 28 Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth, fainteth not, neither is weary? there is no searching of his understanding. Replication. Timothy G. Standish, Ph. D. The Information Catch 22.
Isaiah 40:28
E N D
Presentation Transcript
Isaiah 40:28 28 Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth, fainteth not, neither is weary? there is no searching of his understanding.
Replication Timothy G. Standish, Ph. D.
The Information Catch 22 With only poor copying fidelity, a primitive system could carry little genetic information without L [the mutation rate] becoming unbearably large, and how a primitive system could then improve its fidelity and also evolve into a sexual system with crossover beggars the imagination." Hoyle F., "Mathematics of Evolution", [1987], Acorn Enterprises: Memphis TN, 1999, p20
Tools of Replication • Enzymes are the tools of replication: • DNA Polymerase - Matches the correct nucleotides then joins adjacent nucleotides to each other • Primase - Provides an RNA primer to start polymerization • Ligase - Joins adjacent DNA strands together (fixes “nicks”)
More Tools of Replication • Helicase - Unwinds the DNA and melts it • Single Strand Binding Proteins - Keep the DNA single stranded after it has been melted by helicase • Gyrase - A topisomerase that Relieves torsional strain in the DNA molecule • Telomerase - Finishes off the ends of DNA strands
Extension - The Replication Fork 3’ 5’ 5’ 3’ 3’ 5’ 3’ Primase - Makes RNA primers 5’ Single strand binding proteins - Prevent DNA from re-anealing Laging Strand 5’ 5’ 3’ 5’ RNA Primers DNA Polymerase 5’ 3’ Gyrase - Relieves torsional strain Helicase - Melts DNA Leading Strand 5’ 3’ Okazaki fragment
Extension - Okazaki Fragments DNA Pol. 5’ 3’ 3’ 5’ Okazaki Fragment RNA Primer DNA Pol. 5’ 3’ 3’ 5’ RNA Primer RNA and DNA Fragments 5’ 3’ 3’ 5’ RNA Primer Nick DNA Polymerase has 5’ to 3’ exonuclease activity. When it sees an RNA/DNA hybrid, it chops out the RNA and some DNA in the 5’ to 3’ direction. DNA Polymerase falls off leaving a nick. Ligase The nick is removed when DNA ligase joins (ligates) the DNA fragments.
The Role of DNA Gyrase Helicase
The Role of DNA Gyrase Supercoiled DNA Helicase Gyrase
The Role of DNA Gyrase Gyrase
The Role of DNA Gyrase Gyrase
The Role of DNA Gyrase Gyrase
The Role of DNA Gyrase Gyrase
The Role of DNA Gyrase Gyrase
The Role of DNA Gyrase Gyrase
The Role of DNA Gyrase Gyrase
The Role of DNA Gyrase Gyrase
The Role of DNA Gyrase Gyrase
E. coli has three identified DNA polymerases each of which has significantly different physical characteristics and roles in the cell E. coli DNA Polymerases Polymerase I II III 5’- 3’ Polymerization Yes Yes Yes 3’-5’ Exonuclease Yes Yes Yes 5’-3’ Exonulcease Yes No No Molecules/cell 400 ? 15 Major function Proofreading/ Removal of RNA primers 109,000 Daltons Repair of damaged DNA Replication polymerization 10 subunits 600,000 Daltons Klenow fragment (76,000 Daltons), prepared by mild proteolysis, lacks 5’ to 3’ exonuclease activity and is used in sequencing
Telomerase Telomere 5’ 3’ 3’ 5’ Degradation of RNA primer at the 5’ end 5’ 3’ 3’ 5’ Next replication 5’ 3’ + 3’ 5’ 3’ 5’ 5’ 3’ At the end of linear chromosomes the lagging strand can’t be completed as the last primer is removed and no 3’ hydroxyl group is available for DNA polymerase to extend from
Telomerase Telomerase 5’GACCGAGCCTCTTGGGTTG 3’CTGGCTCGG AACCCCAAC RNA Telomerase is a ribo-protein complex that adds nucleotides to the end of chromosomes thus restoring their length GGGTTG
Telomerase Telomerase 5’GACCGAGCCTCTTGGGTTG 3’CTGGCTCGG AACCCCAAC RNA Telomerase is a ribo-protein complex that adds nucleotides to the end of chromosomes thus restoring their length GGGTTG GGGTTG
Telomerase Telomerase 5’GACCGAGCCTCTTGGGTTG 3’CTGGCTCGG AACCCCAAC RNA Telomerase is a ribo-protein complex that adds nucleotides to the end of chromosomes thus restoring their length GGGTTG GGGTTG GGGTTG
Telomerase O O H H N N 5’GACCGAGCCTCTTGGGTTGGGGTTGGGGTTGGGGTTG N N 3’CTGGCTCGG H H N N N N Guanine N N H H Guanine The TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing
Telomerase The TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing DNA Pol. 5’GACCGAGCCTCTTGGGTTGGGGTTGGGG GGGGTTG T T 3’GTTGGGG 3’CTGGCTCGG
Telomerase Endo- nuclease The TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing DNA Pol. 5’GACCGAGCCTCTTGGGTTGGGGTTGGGG T T AGAACCCAACCCGTTGGGG 3’CTGGCTCGG
Telomerase Endo- nuclease GTTGGGG T T GTTGGGG The TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing 5’GACCGAGCCTCTTGGGTTGGG AGAACCCAACCC 3’CTGGCTCGG
The End
MutationWhen Mistakes Are Made DNA Pol. 5’ 3’ 5’ DNA Pol. 5’ 3’ 5’ 5’ DNA Pol. 5’ 3’ Mismatch 3’ to 5’ Exonuclease activity
MutationExcision Repair 3’ 5’ 3’ 5’ 5’ 5’ 3’ 3’ Endo- Nuclease Thimine Dimer
MutationExcision Repair 3’ 5’ 3’ 3’ 5’ 5’ Nicks 5’ 5’ 5’ 3’ 3’ 3’ Endo- Nuclease DNA Pol.
MutationExcision Repair 3’ 5’ 3’ 5’ DNA Pol. 3’ 5’ 5’ 5’ 5’ 3’ 3’ 3’ Endo- Nuclease
MutationExcision Repair 3’ 5’ 3’ 5’ Nicks 3’ 5’ 5’ 5’ 5’ 3’ 3’ 3’ Ligase Nick Endo- Nuclease Ligase DNA Pol.
O H N N H N N N H
DNA Replication:How We Know Conservative - Old double stranded DNA serves as a template for two new strands which then join together, giving two old strands together and two new strands together Semi-conservative - Old strands serve as templates for new strands resulting in double stranded DNA made of both old and new strands Old New Old New Old Old Old New + + Old + New Old + New Old + New Old + New Old Dispersive - In which sections of the old strands are dispersed in the new strands + + or • There are three ways in which DNA could be replicated:
The Meselson-Stahl Experiment OH NH2 O P HO O N N N N H OH • The Meselson-Stahl experiment demonstrated that replication is semiconservative • This experiment took advantage of the fact that nucleotide bases contain nitrogen • Thus DNA contains nitrogen • The most common form of Nitrogen is N14 with 7 protons and 7 neutrons • N15 is called “heavy nitrogen” as it has 8 neutrons thus increasing its mass by 1 atomic mass unit
The Meselson-Stahl Experiment Transfer to normal N14 media Conservative model prediction Dispersive model prediction Semi-conservative model prediction After 20 min. (1 replication) transfer DNA to centrifuge tube and centrifuge Bacteria grown in N15 media for several replications X The conservative and dispersive models make predictions that do not come true thus, buy deduction, the semi-conservative model must be true. Prediction after 2 or more replications X X
The Current Eukaryotic Recombination Model Homologous chromosomes Meiosis Prophase I
The Current Eukaryotic Recombination Model Double strand break Exo- nuclease
The Current Eukaryotic Recombination Model Exo- nuclease
The Current Eukaryotic Recombination Model Exo- nuclease
The Current Eukaryotic Recombination Model Exo- nuclease
The Current Eukaryotic Recombination Model DNA Polymerase
The Current Eukaryotic Recombination Model DNA Polymerase
The Current Eukaryotic Recombination Model DNA Polymerase
The Current Eukaryotic Recombination Model DNA Polymerase
Holliday Structure Bend
Holliday Structure Bend Twist