virgil
Uploaded by
56 SLIDES
806 VUES
570LIKES

Isaiah 40:28

DESCRIPTION

Isaiah 40:28 28 Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth, fainteth not, neither is weary? there is no searching of his understanding. Replication. Timothy G. Standish, Ph. D. The Information Catch 22.

1 / 56

Télécharger la présentation

Isaiah 40:28

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Isaiah 40:28 28 Hast thou not known? hast thou not heard, that the everlasting God, the LORD, the Creator of the ends of the earth, fainteth not, neither is weary? there is no searching of his understanding.

  2. Replication Timothy G. Standish, Ph. D.

  3. The Information Catch 22 With only poor copying fidelity, a primitive system could carry little genetic information without L [the mutation rate] becoming unbearably large, and how a primitive system could then improve its fidelity and also evolve into a sexual system with crossover beggars the imagination." Hoyle F., "Mathematics of Evolution", [1987], Acorn Enterprises: Memphis TN, 1999, p20

  4. Tools of Replication • Enzymes are the tools of replication: • DNA Polymerase - Matches the correct nucleotides then joins adjacent nucleotides to each other • Primase - Provides an RNA primer to start polymerization • Ligase - Joins adjacent DNA strands together (fixes “nicks”)

  5. More Tools of Replication • Helicase - Unwinds the DNA and melts it • Single Strand Binding Proteins - Keep the DNA single stranded after it has been melted by helicase • Gyrase - A topisomerase that Relieves torsional strain in the DNA molecule • Telomerase - Finishes off the ends of DNA strands

  6. Extension - The Replication Fork 3’ 5’ 5’ 3’ 3’ 5’ 3’ Primase - Makes RNA primers 5’ Single strand binding proteins - Prevent DNA from re-anealing Laging Strand 5’ 5’ 3’ 5’ RNA Primers DNA Polymerase 5’ 3’ Gyrase - Relieves torsional strain Helicase - Melts DNA Leading Strand 5’ 3’ Okazaki fragment

  7. Extension - Okazaki Fragments DNA Pol. 5’ 3’ 3’ 5’ Okazaki Fragment RNA Primer DNA Pol. 5’ 3’ 3’ 5’ RNA Primer RNA and DNA Fragments 5’ 3’ 3’ 5’ RNA Primer Nick DNA Polymerase has 5’ to 3’ exonuclease activity. When it sees an RNA/DNA hybrid, it chops out the RNA and some DNA in the 5’ to 3’ direction. DNA Polymerase falls off leaving a nick. Ligase The nick is removed when DNA ligase joins (ligates) the DNA fragments.

  8. The Role of DNA Gyrase Helicase

  9. The Role of DNA Gyrase Supercoiled DNA Helicase Gyrase

  10. The Role of DNA Gyrase Gyrase

  11. The Role of DNA Gyrase Gyrase

  12. The Role of DNA Gyrase Gyrase

  13. The Role of DNA Gyrase Gyrase

  14. The Role of DNA Gyrase Gyrase

  15. The Role of DNA Gyrase Gyrase

  16. The Role of DNA Gyrase Gyrase

  17. The Role of DNA Gyrase Gyrase

  18. The Role of DNA Gyrase Gyrase

  19. E. coli has three identified DNA polymerases each of which has significantly different physical characteristics and roles in the cell E. coli DNA Polymerases Polymerase I II III 5’- 3’ Polymerization Yes Yes Yes 3’-5’ Exonuclease Yes Yes Yes 5’-3’ Exonulcease Yes No No Molecules/cell 400 ? 15 Major function Proofreading/ Removal of RNA primers 109,000 Daltons Repair of damaged DNA Replication polymerization 10 subunits 600,000 Daltons Klenow fragment (76,000 Daltons), prepared by mild proteolysis, lacks 5’ to 3’ exonuclease activity and is used in sequencing

  20. Telomerase Telomere 5’ 3’ 3’ 5’ Degradation of RNA primer at the 5’ end 5’ 3’ 3’ 5’ Next replication 5’ 3’ + 3’ 5’ 3’ 5’ 5’ 3’ At the end of linear chromosomes the lagging strand can’t be completed as the last primer is removed and no 3’ hydroxyl group is available for DNA polymerase to extend from

  21. Telomerase Telomerase 5’GACCGAGCCTCTTGGGTTG 3’CTGGCTCGG AACCCCAAC RNA Telomerase is a ribo-protein complex that adds nucleotides to the end of chromosomes thus restoring their length GGGTTG

  22. Telomerase Telomerase 5’GACCGAGCCTCTTGGGTTG 3’CTGGCTCGG AACCCCAAC RNA Telomerase is a ribo-protein complex that adds nucleotides to the end of chromosomes thus restoring their length GGGTTG GGGTTG

  23. Telomerase Telomerase 5’GACCGAGCCTCTTGGGTTG 3’CTGGCTCGG AACCCCAAC RNA Telomerase is a ribo-protein complex that adds nucleotides to the end of chromosomes thus restoring their length GGGTTG GGGTTG GGGTTG

  24. Telomerase O O H H N N 5’GACCGAGCCTCTTGGGTTGGGGTTGGGGTTGGGGTTG N N 3’CTGGCTCGG H H N N N N Guanine N N H H Guanine The TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing

  25. Telomerase The TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing DNA Pol. 5’GACCGAGCCTCTTGGGTTGGGGTTGGGG GGGGTTG T T 3’GTTGGGG 3’CTGGCTCGG

  26. Telomerase Endo- nuclease The TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing DNA Pol. 5’GACCGAGCCTCTTGGGTTGGGGTTGGGG T T AGAACCCAACCCGTTGGGG 3’CTGGCTCGG

  27. Telomerase Endo- nuclease GTTGGGG T T GTTGGGG The TTGGGG repeating telomere sequence can form a hairpin due to unusual GG base pairing 5’GACCGAGCCTCTTGGGTTGGG AGAACCCAACCC 3’CTGGCTCGG

  28. The End

  29. MutationWhen Mistakes Are Made DNA Pol. 5’ 3’ 5’ DNA Pol. 5’ 3’ 5’ 5’ DNA Pol. 5’ 3’ Mismatch 3’ to 5’ Exonuclease activity

  30. MutationExcision Repair 3’ 5’ 3’ 5’ 5’ 5’ 3’ 3’ Endo- Nuclease Thimine Dimer

  31. MutationExcision Repair 3’ 5’ 3’ 3’ 5’ 5’ Nicks 5’ 5’ 5’ 3’ 3’ 3’ Endo- Nuclease DNA Pol.

  32. MutationExcision Repair 3’ 5’ 3’ 5’ DNA Pol. 3’ 5’ 5’ 5’ 5’ 3’ 3’ 3’ Endo- Nuclease

  33. MutationExcision Repair 3’ 5’ 3’ 5’ Nicks 3’ 5’ 5’ 5’ 5’ 3’ 3’ 3’ Ligase Nick Endo- Nuclease Ligase DNA Pol.

  34. O H N N H N N N H

  35. DNA Replication:How We Know Conservative - Old double stranded DNA serves as a template for two new strands which then join together, giving two old strands together and two new strands together Semi-conservative - Old strands serve as templates for new strands resulting in double stranded DNA made of both old and new strands Old New Old New Old Old Old New + + Old + New Old + New Old + New Old + New Old Dispersive - In which sections of the old strands are dispersed in the new strands + + or • There are three ways in which DNA could be replicated:

  36. The Meselson-Stahl Experiment OH NH2 O P HO O N N N N H OH • The Meselson-Stahl experiment demonstrated that replication is semiconservative • This experiment took advantage of the fact that nucleotide bases contain nitrogen • Thus DNA contains nitrogen • The most common form of Nitrogen is N14 with 7 protons and 7 neutrons • N15 is called “heavy nitrogen” as it has 8 neutrons thus increasing its mass by 1 atomic mass unit

  37. The Meselson-Stahl Experiment Transfer to normal N14 media Conservative model prediction Dispersive model prediction Semi-conservative model prediction After 20 min. (1 replication) transfer DNA to centrifuge tube and centrifuge Bacteria grown in N15 media for several replications X The conservative and dispersive models make predictions that do not come true thus, buy deduction, the semi-conservative model must be true. Prediction after 2 or more replications X X

  38. The Current Eukaryotic Recombination Model Homologous chromosomes Meiosis Prophase I

  39. The Current Eukaryotic Recombination Model Double strand break Exo- nuclease

  40. The Current Eukaryotic Recombination Model Exo- nuclease

  41. The Current Eukaryotic Recombination Model Exo- nuclease

  42. The Current Eukaryotic Recombination Model Exo- nuclease

  43. The Current Eukaryotic Recombination Model DNA Polymerase

  44. The Current Eukaryotic Recombination Model DNA Polymerase

  45. The Current Eukaryotic Recombination Model DNA Polymerase

  46. The Current Eukaryotic Recombination Model DNA Polymerase

  47. The Current Eukaryotic Recombination Model

  48. Holliday Structure

  49. Holliday Structure Bend

  50. Holliday Structure Bend Twist

More Related