1 / 30

Objective: You will be able to list the positives and negatives of genetic engineering

Objective: You will be able to list the positives and negatives of genetic engineering. Do Now: Read “Increasing variation” which starts on p. 320 and ends on page 321 Give one example of a new bacteria that was reproduced Give one example of a new plant that was reproduced.

wesley-acosta
Télécharger la présentation

Objective: You will be able to list the positives and negatives of genetic engineering

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Objective:You will be able to list the positives and negatives of genetic engineering Do Now: Read “Increasing variation” which starts on p. 320 and ends on page 321 Give one example of a new bacteria that was reproduced Give one example of a new plant that was reproduced

  2. Genetic Engineering • This is a new technology used to change the genetic instructions in individuals

  3. Why would you want to change the genetic instructions in an organism? • To allow the organism to do something new • Ex. Insert a gene into crops to allow them to make a protein to fight of a fungus • For gene therapy • A defective gene is replaced with a “good” gene

  4. Objective:You will be able to describe how DNA is removed from one cell and added to another cell. Do Now: • Read all of p. 327 • Define transformation • What is a plasmid?

  5. 1. Copy the following series of DNA nucleotides onto a sheet of paper. GTACTAGGTTAACTGTACTATCGTTAACGTAAGCTACGTTAACCTA 2. Look carefully at the series, and find this sequence of letters: GTTAAC. It may appear more than once. 3. When you find it, divide the sequence in half with a mark of your pencil. You will divide it between the T and the A. This produces short segments of DNA. How many occurrences of the sequence GTTAAC can you find? Interest Grabber continued Section 13-2

  6. Restriction Enzymes Recognition sequences Section 13-2 Recognition sequences are the places on the DNA where an enzyme will cut it

  7. Restriction Enzymes Recognition sequences Section 13-2 Sticky end

  8. Figure 13-9 Making Recombinant DNA Section 13-3 Gene for human growth hormone Recombinant DNA Gene for human growth hormone DNA recombination Human Cell Sticky ends DNA insertion Bacterial Cell Bacterial chromosome Bacterial cell for containing gene for human growth hormone Plasmid

  9. Mixed DNA • When you combine DNA from two individuals, we call it recombinant DNA

  10. Figure 17.5 A tobacco plant expressing a firefly gene

  11. Objective: You will be able to explain how gel electrophoresis separates pieces of DNA. • Read the section named “The tools of molecular Biology” on p. 322-323 • How is DNA cut? • How is DNA separated?

  12. Use of Restriction Enzymes • Restriction enzymes cut DNA whenever they see a specific sequence of bases. • The pieces of cut DNA are called restriction fragments • Each person has a different DNA sequence • So restriction enzymes will cut each person’s DNA into different sized pieces.

  13. We can use a process called gel electrophoresis to separate the pieces

  14. Figure 20.x1a Laboratory worker reviewing DNA band pattern

  15. Gel Electrophoresis • Moves DNA because it is negative • Separates DNA fragments based on size • The smaller the fragment the farther it will move • Can compare DNA from individuals

  16. Figure 20.17 DNA fingerprints from a murder case

  17. Figure 20.9 Using restriction fragment patterns to distinguish DNA from different alleles

  18. Objective: You will be able to explain how selective breeding can be used to improve offspring. Do Now • Read all of page 310 • Define selective breeding • Define hybridization

  19. Interest Grabber The tomatoes in your salad and the dog in your backyard are a result of selective breeding.

  20. Labrador retriever

  21. Poodle

  22. Labradoodles?

  23. Goldendoodle?

  24. Can you think of some selective breeding examples

  25. Objective: You will be able to describe the process of cloning. • How can a sheep that is 12 years old have a twin that is 4 years old?

  26. Flowchart Section 13-4 Cloning A body cell is taken from a donor animal. An egg cell is taken from a donor animal. The nucleus is removed from the egg. The body cell and egg are fused by electric shock. The fused cell begins dividing, becoming an embryo. The embryo is implanted into the uterus of a foster mother. The embryo develops into a cloned animal.

  27. A donor cell is taken from a sheep’s udder. Section 13-4 These two cells are fused using an electric shock. Donor Nucleus An egg cell is taken from an adult female sheep. Fused Cell Egg Cell The nucleus of the egg cell is removed. Foster Mother Embryo The embryo develops normally into a lamb—Dolly The fused cell begins dividing normally. The embryo is placed in the uterus of a foster mother. Cloned Lamb

More Related