Overview of mRNA Splicing: Mechanisms and Clinical Implications in β-Thalassemia
This overview discusses the role of mRNA splicing factors like U1 and U2 snRNP in splice site identification and exon selection. It highlights the importance of exon selection factors in recognizing RNA sequences, which is crucial for correct splicing. The piece also delves into β-globin splice mutations and their implications in β-thalassemia, exploring how improper splicing can lead to premature stop codons and subsequent Nonsense Mediated Decay (NMD). Furthermore, potential therapeutic strategies to manage disorders resulting from such mutations are outlined.
Overview of mRNA Splicing: Mechanisms and Clinical Implications in β-Thalassemia
E N D
Presentation Transcript
Overview of mRNA Splicing Factors such as U1 and U2 snRNP identify splice sites Exon selection factor Exon selection factor U1 snRNP U2 snRNP Exon 1 AGGU Intron 1 A AGG Exon 2 Exons are identified by RNA sequences within the exons that are recognized by exon selection factors.
Beta globin splice mutations are one cause of beta thalassemia EXON1 INTRON1 PHENOTYPE AG GT AGT CONSENSUS GCCAG GTTGGTAT NORMAL GCCAG ATTGGTAT 0 (no beta chains) GCCAG TTTGGTAT 0 (no beta chains) GCCAG GTTGTTAT + (some beta chains) GCCAG GTTGCTAT + (some beta chains) GCCAG GTTGGCAT + (some beta chains) A G
Beta globin splice mutations:creation of a new acceptor site NORMAL: INTRON 1 EXON 2 TATTGGTCTATTTTCCCACCCTTAG GCTG MUTATION: TATTAGTCTATTTTCCCACCCTTAGGCTG TATTAG TCTATTTTCCCACCCTTAGGCTG 100% Normal site used 10% of the time: normal protein from these RNAs 10% 10% 19 nucleotides 90% Net result: this allele shows a 90% reduction in β-globin production New site used 90% of the time: no protein from these RNAs (note the shift in reading frame).
Nonsense Mediated Decay A. Normal stop codon is downstream or <50 bases upstream from splice junction Last exon Translation Exon/Exon junction B. Premature stop codon >50 bases upstream from splice junction >50 bases Last exon mRNA Decay
Nonsense Mediated Decay Origin of premature stop codons - Improper splicing - intron retained - frameshift - Mutation Possible consequences of premature stop codons: - non functional protein - formation of amyloid - loss of a regulatory region from a protein that regulates growth cancer
Nonsense Mediated Decay Normal Stop Codon Spliceosomes Nucleus Cytoplasm Exon/Exon junctions Protein complexes (Exon-junction-complexes; EJC) 1st round of Translation Complexes removed by ribosome transit More translation
Nonsense Mediated Decay Spliceosomes Nucleus Cytoplasm Normal stop codon Premature stop codon Exon/Exon junctions Protein complexes (Exon-junction-complexes; EJC) 1st round of Translation Complex not removed Stopped ribosome mRNA Decay
Nonsense mediated DecayClinical applications (in trials) • Some drugs that affect the accuracy of codon recognition by ribosomes (such as gentamicin) decrease Nonsense mediated decay. • Treatment with these drugs allows a low level of expression from genes with premature stop codons. • Possible treatment for several disorders including some alleles of cystic fibrosis. Reference: Holbrook et al Nature Genetics 36:801-808 (2004)
The core promoter -30 start of transcription +30 TATA box For most (but not all) promoters, a complex of proteins is assembled around the TATA box, located about 25-30 b.p. upstream from the start site. The consensus sequence of the TATA box is TATAAA
DNA with TATA box binding protein Protein DNA
The core promoter -30 start of transcription +30 TATA binding protein The TATA binding protein binds to the TATA box
The core promoter -30 start of transcription +30 TFII-D The TATA binding protein is one subunit of a large complex: TFII-D.
The core promoter TFII-F TFII-A -30 start of transcription +30 TFII-B TFII-D Several other complexes bind to TFII-D.
The core promoter TFII-F TFII-A -30 start of transcription +30 TFII-B TFII-D RNA pol II RNA polymerase is recruited to the promoter.
The core promoter TFII-F TFII-A -30 start of transcription +30 TFII-B TFII-D RNA pol II TFII-H The factor TFII-H plays a key role in initiating transcription by phosphorylating the C-terminal domain of the large subunit of RNA pol II.
CTD: a pol II switchCTD:The COOH Terminal Domain of the RNA pol II large subunit …...(Tyr-Ser-Pro-Thr-Ser-Pro-Ser)52COOH
CTD: a pol II switchCTD: The COOH Terminal Domain of the RNA pol II large subunit TFIIH controls the start of transcription …...(Tyr-Ser-Pro-Thr-Ser-Pro-Ser)52COOH TFIIH …...(Tyr-Ser-Pro-Thr-Ser-Pro-Ser)52COOH PO3phosphorylated Ser 5 of the repeats Other kinases More phosphorylation of the CTD ATP ADP ATP ADP
CTD: a pol II switchCTD: The COOH Terminal Domain of the RNA pol II large subunit Unphosphorylated CTD: Involved in initiation: Binding of initiation factors Phosphorylated CTD: Involved in elongation & RNA processing Binds components involved in RNA capping Binds components involved in RNA splicing Binds components involved in 3’ end formation
The CTD ties elongation to capping, splicing and 3’-end formation From Orphanadies & Reinberg (2002) Cell 108:439-51
A model promoter HAT Core Promoter Binds general transcriptional machinery Histone Acetyl Transferase CREB CREB Fos Jun pol II SP-1 D B NR NR H F TGACTCA GACGTC TATAAA HRE GGGCGG E HRE (Hormone Response Element) Regulation by hormones such as estrogen which enter the cell SP-1 Site Provides basal unregulated transcriptional activity. Many genes have multiple SP-1 sites AP-1 (Fos-Jun binding site) Regulation by growth factors, stress, and various transmembrane signals CRE (Cyclic AMP Response Element) Regulation by cAMP, and by Ca+. Interacts with core promoter (through CREB Binding Protein) and modifies chromatin structure (through HAT). Positions of these elements are relatively unimportant
Phosphorylation of CREB and the CREB binding protein (CBP) HAT Serine 133
Signaling mediated by cAMP and protein kinase A Hormone Hormone receptor Plasma membrane ATP G Adenylate cyclase G-protein cAMP Active Protein Kinase A Inctive Protein Kinase A Nuclear membranes Active pKA enters the nucleus and phosphorylates CREB on Serine 133 PO4 PO4 Core promoter Phosphorylation of CREB: - stimulates interactions with several core promoter proteins - induces binding of HAT and acetylation of histones