Uploaded by yitta

1 SLIDES

254 VUES

10LIKES

16S amplicon

DESCRIPTION

Ligation Detection Reaction. Pfu DNA Ligase. Discriminating oligo. Common Probe. Cy3. OH. P. cZip code. GCAATTACGGATT. CGCIIATTTAC G. 16S amplicon. GCGIITAAATG C CGTTAATGCCTAA. Perfect match. Ligation product. Cy3. cZip code. CGCIIATTTAC G GCAATTACGGATT A. A.

16S amplicon

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Ligation Detection Reaction Pfu DNA Ligase Discriminating oligo Common Probe Cy3 OH P cZip code GCAATTACGGATT CGCIIATTTACG 16S amplicon GCGIITAAATGCCGTTAATGCCTAA Perfect match Ligation product Cy3 cZip code CGCIIATTTACGGCAATTACGGATT A A 16S amplicon GCGIITAAATGCCGTTAATGCCTAA Detection on chip Ligation MIX DNA ‘universal’chip’ Zip 1 Spacer (polyA) Cy3 Spacer (polyA) cZip 3 SLIDE CGCIIATTTACGGCAATTACGGATT Ligationproduct Zip 3 Spacer (polyA) Spacer (polyA) Zip 4 B

PCR amplification of 16S rRNA gene

16S rRNA geneThe sequence of the 16S rRNA gene has been widely used as a means to identify an unknown bacterium to the genus or species level. The Polymerase Chain Reaction (PCR) is a technique that allows the production of more than 10 million copies of a target DNA sequence from only a few mole

1.56k views • 6 slides

Genboree Microbiome Workbench 16S Workshop Part I

Genboree Microbiome Workbench 16S Workshop Part I. March 11 th , 2014 Julia Cope Emily Hollister Kevin Riehle. Genboree Workflow. Create Group Create Database Create Project Upload Files  Create Samples (Sample Import using metadata file) 

449 views • 33 slides

16S phylogeny of the Streptomycetaceae

16S phylogeny of the Streptomycetaceae. Alan Ward. 16S phylogeny of the Streptomycetaceae. Outline. Motivation Streptomyces taxonomy 16S Whole genome sequencing A bigger 16S phylogeny Where is the diversity The type strains Uncultured diversity Where are: The whole genomes

567 views • 28 slides

Meta-Genomics by 16S

Meta-Genomics by 16S. Mark Reimers, Moscow Genomic Data Analysis 2012. Outline. What is Metagenomics ? biological questions and statistical issues What’s there? Identification issues How have things changed? Characterizing differences in microbial communities. What is Meta-genomics?.

939 views • 38 slides

ACTIVITIES SPRING TERM 2010 Under 16s

ACTIVITIES SPRING TERM 2010 Under 16s.

83 views • 1 slides

Genboree Microbiome Workbench 16S Workshop Part I

Genboree Microbiome Workbench 16S Workshop Part I. March 11 th , 2014 Julia Cope Emily Hollister Kevin Riehle. Genboree 16S Workshop. Learning Objectives Students should be able to take .sff files and user supplied information and produce: Metadata File PCoA Classification Distribution

335 views • 22 slides

FINGER-PRINTING OF BACTERIA 16s ribosomal rna

FINGER-PRINTING OF BACTERIA 16s ribosomal rna. Made by :- Rahma Ahmed . Amira Amer . UNDER THE SUPERVISION OF :- . Dr Nabil Hegazi . . CONTENTS. 1-Definition of 16s rRNA . 2-16s rRNA as a finger-printing of bacterial identification. 3- Sequencing of 16s rRNA .

533 views • 20 slides

Amplicon Vaccine LLC Pullman, Washington USA amplicon-vaccine Robert Bogden - President

Repro-Bloc TM A Cloned LHRH (GnRH) Vaccine for Mammalian Reproductive Control Presentation Focuses on TWO Cattle Studies. Amplicon Vaccine LLC Pullman, Washington USA www.amplicon-vaccine.com Robert Bogden - President. Presentation Contents. Inventors of Repro-Bloc technology

547 views • 34 slides

16S rRNA

284 views • 2 slides

Accurate estimation of microbial communities using 16S tags

Accurate estimation of microbial communities using 16S tags. Julien Tremblay, PhD jtremblay@lbl.gov. 16S rRNA as phylogenetic marker gene. 21 proteins. 16S rRNA. 30S. 70S Ribosome. subunits. 50S. 5S rRNA. Escherichia coli 16S rRNA Primary and Secondary Structure. 34 proteins.

410 views • 24 slides

Amplicon 1

Supplementary Figure 1. a. Amplicon 4. Amplicon 6. Amplicon 3. Amplicon 5. Amplicon 2. Amplicon 1. CD24L4. 5’. 3’. 1100bp downstream region. 3500bp upstream region. putative 2195 bp CD24L4 mRNA. -A662G. b. Amplicon 3. Amplicon 4. Amplicon 2. Amplicon 5. Amplicon 7.

144 views • 1 slides

Metabarcoding 16S RNA targeted sequencing

Metabarcoding 16S RNA targeted sequencing. Peter Tsai Bioinformatics Institute, University of Auckland. Overview. What’s metagenomics and metabarcoding ? Next generation sequencing and metabarcoding How NGS changes metagenomics Analysis approach

402 views • 18 slides

Amplicon -Based Quasipecies Assembly Using Next Generation Sequencing

Amplicon -Based Quasipecies Assembly Using Next Generation Sequencing. Nick Mancuso Bassam Tork Computer Science Department Georgia State University. Outline of HCV Quasispecies. HCV quasispecies Problem formulation Amplicon based model Error model Frequency model Solution method

437 views • 32 slides

16S rDNA Analysis after Biofield Treatment

Citrobacter braakii (C. braakii) is widespread in nature, mainly found in human urinary tract. The current study was attempted to investigate the effect of Mr. Trivedi’s biofield treatment on C.

190 views • 8 slides

Genotypic Analysis of Morganella morganii using 16S rDNA

A test conducted to analyse the genotype using 16S rDNA after Biofield energy treatment on morganella morganii. A test conducted by Mahendra Trivedi and Team.

150 views • 9 slides

P. Fluorescens - 16S rDNA Sequencing Analysis

In the present study, the Pseudomonas fluorescens sample was treated with the alternative energy treatment and evaluated for Bacterial identification using 16S rDNA gene sequencing and antibiogram analysis.

188 views • 9 slides

amplicon sequencing

Whether you would like to detect the diversity of microbial communities or discover rare somatic mutations in complex samples. CD Genomics could provide professional, cost-efficient and high-speed amplicon sequencing services to meet your project requirements.

79 views • 3 slides

Analysis of your 16s RNA

Analysis of your 16s RNA. DNA sequencing. Most current sequencing projects use the chain termination method Also known as Sanger sequencing, after its inventor Based on action of DNA polymerase Adds nucleotides to complementary strand Requires template DNA and primer.

295 views • 19 slides

Your Debt Recovery Partner | Best Debt Collection Agency | Amplicon LLC

https://ampliconinc.com/ - Amplicon, a modern collection company, helps you to easily recover your toughest debts. We strive hard to provide our customers with the best data, technology, process, and results. You can count on us to amplify your receivables. We keep you updated with your debt collection using routine data around your outstanding accounts receivables and bad debt collections. We can help you solve your toughest debt recovery challenges with our First Party Collection Services or Third Party Collection Services.

28 views • 1 slides

More Related