1 / 12

Genetic Mutations

Genetic Mutations. Frameshift Mutation. Thesunwashotbuttheoldmandidnotgethishat . Reading Frame The/sun/was/hot/but/the/old/man/did/not/get/his/hat. Thesunwashotbuttheoldmandidnotgethishat . Frameshift T/ hes / unw /ash/ otb / utt / heo / ldm /and/ idn / otg /eth/ ish /at.

yukio
Télécharger la présentation

Genetic Mutations

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Genetic Mutations

  2. Frameshift Mutation Thesunwashotbuttheoldmandidnotgethishat. Reading Frame The/sun/was/hot/but/the/old/man/did/not/get/his/hat. Thesunwashotbuttheoldmandidnotgethishat. Frameshift T/hes/unw/ash/otb/utt/heo/ldm/and/idn/otg/eth/ish/at.

  3. Point Mutation: Deletion Thesunwashotbuttheoldmandidnotgethishat. Reading Frame The/sun/was/hot/but/the/old/man/did/not/get/his/hat Thesunwasotbuttheoldmandidnotgethishat. Reading Frame The/sun/was/otb/utt/heo/ldm/and/idn/otg/eth/ish/at. Frameshift What happened to the reading frame? How many words are still correct?

  4. Point Mutation: Addition Thesunwashotbuttheoldmandidnotgethishat. Reading Frame The/sun/was/hot/but/the/old/man/did/not/get/his/hat Thesunwasshotbuttheoldmandidnotgethishat. Reading Frame The/sun/was/sho/tbu/tth/eol/dma/ndi/dno/tge/thi/sha/t. • Frameshift What happened to the reading frame? How many words are still correct?

  5. Point Mutation: Substitution Thesunwashotbuttheoldmandidnotgethishat. Reading Frame The/sun/was/hot/but/the/old/man/did/not/get/his/hat Thesunwasnotbuttheoldmandidnotgethishat. Reading Frame The/sun/was/not/but/the/old/man/did/not/get/his/hat. What happened to the reading frame? How many words are still correct?

  6. Frameshift Mutation GCATGCTGCGAAACATTGGCTGA Reading Frame GCA/TGC/TGC/GAA/ACA/TTG/GCT/GA mRNA: CGU/ACG/ACG/CUU/UGU/AAC/CGA/CU Amino acid: arg-thr-thr-leu-cys-asp-arg GCATGCTGCGAAACATTGGCTGA Frame Shift G/CAT/GCT/GCG/AAA/CAT/TGG/CTG/A mRNA: C/GUA/CGA/CGC/UUU/GUA/ACC/GAC/U Amino acid: val-arg-arg-phe-val-thr-aspt How many amino acids are correct?

  7. Point Mutation: Deletion GCA/TGC/TGC/GAA/ACA/TTG/GCT/GA mRNA: CGU/ACG/ACG/CUU/UGU/AAC/CGA/CU Amino acid: arg-thr-thr-leu-cys-asp-arg GCATGCTGCGAAACATTGGCTGA Reading Frame GCATCTGCGAAACATTGGCTGA Reading Frame GCA/TCT/GCG/AAA/CAT/TGG/CTG/A mRNA: CGU/AGA/CGC/UUU/GUA/ACC/GAC/U Amino acid: arg-arg-arg-phe-val-thr-aspt What happened to the reading frame? How many amino acids are still correct?

  8. Point Mutation: Insertion GCA/TGC/TGC/GAA/ACA/TGG/GCT/GA mRNA: CGU/ACG/ACG/CUU/UGU/ACC/CGA/CU Amino acid: arg-thr-thr-leu-thr-asp-arg GCATGCTGCGAAACATGGGCTGA Reading Frame GCATAGCTGCGAAACATGGGCTGA Reading Frame GCA/TAG/CTG/CGA/AAC/ATG/GGC/TGA mRNA: CGU/AUC/GAC/GCU/UUG/UAC/CCG/ACU Amino acid: arg-iso-aspt-ala-leu-tyr-pro-thr What happened to the reading frame? How many amino acids are still correct?

  9. Point Mutation: Substitution GCA/TGC/TGC/GAA/ACA/TTG/GCT/GA mRNA: CGU/ACG/ACG/CUU/UGU/AAC/CGA/CU Amino acid: arg-thr-thr-leu-cys-asp-arg GCATGCTGCGAAACATTGGCTGA Reading Frame GCATTCTGCGAAACATTGGCTGA Reading Frame GCA/TTC/TGC/GAA/ACA/TTG/GCT/GA mRNA: CGU/AAG/ACG/CUU/UGU/AAC/CGA/CU Amino acid: arg-lys-thr-leu-cys-asp-arg What happened to the reading frame? How amino acids are still correct?

  10. Missense Mutation: GCA/TGC/TGC/GAA/ACA/TTG/GCT/GA mRNA: CGU/ACG/ACG/CUU/UGU/AAC/CGA/CU Amino acid: arg-thr-thr-leu-cys-asp-arg GCATGCTGCGAAACATTGGCTGA Reading Frame GCATCCTGCGAAACATTGGCTGA Reading Frame GCA/TCC/TGC/GAA/ACA/TTG/GCT/GA mRNA: CGU/AGG/ACG/CUU/UGU/AAC/CGA/CU Amino acid: arg-arg-thr-leu-cys-asp-arg What happened to the reading frame? How amino acids changed?

  11. Nonsense Mutation: GCA/TGC/TGC/GAA/ACA/TTG/GCT/GA mRNA: CGU/ACG/ACG/CUU/UGU/AAC/CGA/CU Amino acid: arg-thr-thr-leu-cys-asp-arg GCATGCTGCGAAACATTGGCTGA Reading Frame GCATGCTGCGAAACTTTGGCTGA Reading Frame GCA/TGC/TGC/GAA/ACT/TTG/GCT/GA mRNA: CGU/ACG/ACG/CUU/UGA/AAC/CGA/CU Amino acid: arg-thr-thr-Stop What happened to the reading frame? How amino acids changed?

  12. Silent Mutation: GCA/TGC/TGC/GAA/ACA/TTG/GCT/GA mRNA: CGU/ACG/ACG/CUU/UGU/AAC/CGA/CU Amino acid: arg-thr-thr-leu-cys-asp-arg GCATGCTGCGAAACATTGGCTGA Reading Frame GCATGGTGCGAAACATTGGCTGA Reading Frame GCA/TGG/TGC/GAA/ACA/TTG/GCT/GA mRNA: CGU/ACC/ACG/CUU/UGU/AAC/CGA/CU Amino acid: arg-thr-thr-leu-cys-asp-arg What happened to the reading frame? How amino acids changed?

More Related