1 / 19

Stone Age Genomics

Stone Age Genomics. Nature, 1987.

april-houston
Télécharger la présentation

Stone Age Genomics

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Stone Age Genomics

  2. Nature, 1987 Mitochondrial DNA from 147 people, drawn from five geographic populations have been analyzed by restriction mapping. All these mtDNAs stem from one woman who is postulated to have lived about 200,000 years ago, probably in Africa. All the populations examined except the African population have multiple origins, impling that each area was colonized repeatedly.

  3. Mitochondrial Eve hypothesis • All living people could be traced back to a single female • She lived ~200,000 years ago • She came from a population of about 10,000 individuals • That population is the founding population for humans • Descendents spread into the rest of the Old World and replaced any existing populations of various species of sapiens or erectus • Consistent with the out-of-Africa model / single-origin model

  4. Mitochondrial DNA • 16, 569 base pairs • Located in organelle responsible for energy metabolism • Each cell has 100s of mitochondria • Has 37 genes • Accumulates mutations on average 10x faster than nDNA • Good for tracking relatively recent evolutionary events • Comes only from mother • Clonal haploid transmission • No recombination of maternal and paternal genes

  5. Surprises…. • Amount of variation of mtDNA in humans is quite low (1/10 of that of chimps) • Maybe because we evolved recently? • Was there a bottleneck that reduced variation? • Since we know our population overlapped with Neanderthal, do we share mtDNA?

  6. H. sapiens vs. H. neanderthalensis • Of 16,568 nucleotides • 206 differed from that of Neanderthal • Among 53 modern humans you will find 2 – 118 differences • Neanderthal sequences is outside of the range of variation among modern humans

  7. This is strange because… • It is quite plausible that there was interbreeding because H. sapiens and H. neanderthalensis lived in overlapping ranges as recent as 30,000 years ago. • Estimated common ancestry between the two using mtDNA shows 660,000 years ago. • Maybe only human female by Neanderthal male matings occurred (never the reverse) • We may have to sample all 400 fossils of Neanderthal to have a good sample • Preliminary nDNA studies also do not show a recent ancestor with neanderthalensis but instead show ancestries of ~700,000 years ago

  8. http://www.africanancestry.com

  9. …Considerable caution is warranted when assessing claims to be able to trace ancestry… • mtDNA diversity is larger within Africa than outside of Africa • Poor sampling coverage (especially central Africa) • Many groups in Africa were widely dispersed before slave trade • Bantu dispersal is a recent phenomenon

  10. The most important translocation in human history • A mutation resulting from attachment of a chromosomal fragment to a nonhomologous chromosome

  11. The most important translocation in human history

  12. CHROMOSOME PARTS HeadTelomere All Chromosomes have telomeres at their ends(like shoelace aglets!) Centromere TailTelomere Telomeres have a unique DNA sequence… ttagggttagggttagggttagggttagggttaggg… |||||||||||||||||||||||||||||||||||| aatcccaatcccaatcccaatcccaatcccaatccc…

  13. PREDICTION Chimp #13 If fusion occurred, then we should see DNA evidence of the head-to-head telomeres together near middle of our #2 chromosome Human #2 Chimp #12 Fusion Area?

  14. EXPECTATIONS • What will you look for? • tandem repeats in fusion area • Where will you look for them? • middle of our chromosome #2 • How can you look for them? • search online DNA database • What if evidence is NOT found? • fusion may not have happened

  15. RESULTS CLARIFIED 108061 agcacagacc tgggggtcac cgtaaaggtg gagcagcatt cccctaagca cagaggttgg 108121 ggccactgcc tggctttgtg acaactcggg gcgcatcaac ggtgaataaa atctttcccg 108181 gttgcagccg tgaataatca aggttagaga ccagttagag cggttcagtg cggaaaacgg 108241 gaaagaaaaa gcccctctga atcctgggca gcgagattct cccaaagcaa ggcgaggggc 108301 tgcattgcagggtgagggtg agggttaggg tttgggttgg gtttggggtt ggggttgggg 108361 taggggtggg gttggggttg gggttggggt taggggtagg ggtaggggta ggggtagggt 108421 cagggtcagg gtcagggtta gggttttagg gttaggattt tagggttagg gtaagggtta 108481 agggttgggg ttggggttag ggttaggggt tagggttggg gttggggttg gggttggggt 108541 tggggttggg gttagggtta gctaaaccta accctaaccc ctaaccccaa ccccaacccc 108601 aaccctaccc ctacccctac ccctaacccc aacccccacc cttaaccctt aacccttacc 108661 ctaaccctaa cccaaaccct aaccctaccc taaccctaac ccaaccctaa ccctaaccct 108721 accctaaccc taacacccta aaaccgtgac cctgaccttg accctgaccc ttaaccctta 108781 accctaacca taaccctaaa ccctaaccct aaaccctaac cctaaaccct aaccctaaca 108841 ctaccctacc ctaaccccaa cccctaaccc ctaaccctaa ccctacccct aaccccaacc 108901 ccagccccaa cccttaccct aaccctaccc taacccttaa ccctaacccc taaccctaac 108961 ccctaaccct aaccctaccc caaccccaaa cccaacccta acccaaccct aacccctaac 109021 cctaacccct accctaaccc ctagccctag ccctagccct aaccctaacc ctcgccctaa 109081 ccctcaccct aaccctcacc ctcaccctaa cccaacgtct gtgctgagaa gaatgctgct 109141 ccgcctttaa ggtgcccccc aggtctgtgc tgaacagaac gcagctccgc cgtcgcagtg 109201 ccctcagccc gcccgcccgg gtctgacctg agaagaactc tgctccgcct tcgcaatagc 109261 cccgaagtct gtgcagagga gaacgcagct ccgccctcgc gatgctctcc ggctgtgtgc 109321 taaagagaac gcaactccgc cctcgcaaag gcggcgcgcc ggcggaggcg cggagaggcg HEAD 13 HEAD 12 See where the head-to-head fusion occurred?

  16. Further ConfirmationComparison of DNA in Our Chrom. #2 with...

  17. Another ConfirmationComparison of DNA in Our Chrom. #3 with...

More Related