1 / 48

Development of proteomics tools to study intranuclear organization Vasily Ogryzko

Development of proteomics tools to study intranuclear organization Vasily Ogryzko Group of “Proteomics & epigenetics ’, UMR 8126 CNRS, Institut Gustave Roussy 15 мая 2014 Программа визитов иностранных учёных в российские научные центры фонда "Династия". Importance of proteomics.

umed
Télécharger la présentation

Development of proteomics tools to study intranuclear organization Vasily Ogryzko

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Development of proteomics tools to study intranuclearorganization Vasily Ogryzko Group of “Proteomics & epigenetics’, UMR 8126 CNRS, Institut Gustave Roussy 15 мая 2014 Программа визитов иностранных учёных в российские научные центры фонда "Династия"

  2. Importance of proteomics One genome Two proteomes

  3. Proteomics: High throughput Study of proteins Questions: Amounts Localization Modifications Interactions Methodology: 2D electrophoresis Mass spectrometry Epitope tagging Proteins: Structure Levels

  4. Challenges of postgenomic era: • Study post-transcriptional steps in gene regulation (microRNA, etc) • Decipher mechanisms of epigenetic regulation • (histone code, other self-perpetuating protein modifications) • Predict function of newly discovered genes • (protein-protein interaction partners) can be addressed by proteomics

  5. Healthcare - Research - Education International Scientific Advisory Board Hospital Activities Research Division Clinical Research Division (DRC) Research Units (IRCIV)

  6. Technology Transfert Company Research Division Eric Solary Scientific Policy Committee Research Coordination and Management Service / Logistics Service Clinical Research Gilles Vassal Platforms Jean-Yves Scoazec Imaging / flow cytometry Animal facility Integrated biology Translational research Tumor collection Biotherapies Bioinformatics Research Units Eric Solary Steering Committee Steering Committee

  7. Proteomicsplatform at IGR Metabolomics platform Integrated Biology Functional genomics platform Lipidomics platform Biological resources center Bioinformatics platform Proteomics platform

  8. Proteomicsplatform at IGR Personnel: Vasily OGRYZKO– DR2, INSERM Alain DEROUSSENT– IR, CNRS Emilie COCHET– Technicienne, IGR Geographic location: IGR, PR2, room 355

  9. Proteomicsplatform at IGR Main instrument: Nano-HPLC/CHIP/ion-trap (Agilent) + Agilent off-gel separator for preanalytic fractionation + Small laboratory equipment

  10. 1. Protein footprinting: motivation Epigenetic information can be encoded in macromolecular interactions Proteins are much more interesting objects than DNA or RNA, i.e. not only their amounts but their conformation and interaction plays essential role

  11. Protein footprinting: motivation Biological system as: Chemical reactor Mechanical device Quantities will tell us nothing Concentrations (quantities) are all what we need

  12. Proteome footprinting: motivation Comparing only protein amounts between proteomes might be looking at the tip of the iceberg 1. Chemical reactor versus machine 2. Differences in protein amounts do not show immediately in many cases, unlike changes in conformations or interactions Need to develop quantitative approaches to monitor changes in protein surfaces in vivo

  13. Protein/proteome footprinting: the principle Protein Identification of modified site Modification Isolated Interacting Protease Mass spec Goals: 1. Monitor surface of a particular protein in vivo 2. Detect changes in protein surfaces on proteome-wide basis

  14. Lysine containing peptide: mono-, di- and trimethylation by DMS 1methyl 2methyl 3methyl 14

  15. Arginine containing peptide: mono- and dimethylation by DMS 14 1methyl 2methyl

  16. Stable isotope DMSD6 produces a mass shift 17 instead of 14 CH3 14 17 CD3

  17. Discrimination between in vitro and in vivo methylation using stable isotopes KCH3 KCD3 KCH3

  18. Footprinting of H2AZ expressed in bacteria Total spectra 850 + 864,867 864 +867

  19. Footprinting of H2AZ expressed in bacteria 658 850 1370 TTSHGR HLQLAIR ATIAGGGVIPHIHK

  20. Footprinting of H2AZ/H2B dimer in vitro +CH3 828.4 +CD3 1168.6 850.5 1370.8

  21. … … A DMSD6 Trypsin, (affinity enrichment) LC-MS/MS DMS Denaturation B 1 2 3 1 Ctrl 2 5 DMS 3 10 4 coomassie

  22. Conclusions Methodology: 1. DMS methylates proteins in vivo 2. Use of stable isotope DMSD6 allows to set up a quantitative approach to monitor reactivity of residues in vivo and in vitro 3. H2AZ and H2B surfaces change after forming H2AZ/H2B dimer

  23. 2. New proteomics-based strategy to study protein-protein interactions in vivo Proximity-Utilizing-Biotinylation (PUB)

  24. Proximity-Utilizing-Biotinylation (PUB) for study interactions between known interaction partners B Protein А BAD Biotinilated I propionilated Retention time (min) Interaction between protein A and B causes biotin transfer and its covalent binding to Lysine of BAD wtBirA ProteinВ 2. Purification of all HisTagproteins On Ni agarose beads, propionic anhydride treatment, trypsin digest wtBirA B Р Biotin ligase (wild type) BAD BAD BAD Biotin Accepting Domain (Short peptide with HisTag) 3. LC-MS/MS Analysisof ratio Biotinylated/propionylated peptides Biotin residue B Propionyl residue P 24

  25. Biotinylation levels are interaction dependent • Protein oligomerisation • (TAP54a vs HP1g) • 2. Binary protein-protein interaction • (KAP1 and HP1) • 3. Different subnuclear domaines • (macroH2A vs H2A.BBD)

  26. Protein oligomerisation (TAP54a vs HP1g) 51 28 51 28 39 39 BAP-HP1g • TAP54a (RuvB-like 1) was shown to exist in oligomers • The heterochromatin proteins HP1 (a, b, g) are also known to oligomerise • But HP1 and Tap54 do not interact PentaHis-HRP Streptavidin-HRP NS 1 2 3 4 1 2 3 4 1 - BAP.Tap54a+BirA.Tap54a 2 - BAP.Tap54a+BirA.HP1g 3 - BAP.HP1g+BirA.Tap54a 4 - BAP. HP1g+BirA. HP1g BAP-TAP54a NS BAP-HP1g Two BAP fusions (HP1 and Tap54) coexpressed with one Bira fusion (HP1 or Tap54) PentaHis-HRP Streptavidin-HRP 1 2 3 1 - control 2 - BAP.Tap54a + BAP.HP1g + BirA.Tap54a 3 - BAP.Tap54a + BAP.HP1g + BirA.HP1g 1 2 3 NS NS BAP-TAP54a NS

  27. Binary protein-protein interaction (HP1 and Kap1) 1 1 2 2 3 3 4 4 1 2 3 4 5 6 7 8 BAP.HP1g + BirA.Kap1 system PentaHis-HRP Streptavidin-HRP 1 - BAP.HP1g+BirA.wtKap1 2 - BAP. HP1g+BirA.mutKap1 3 - BAP.GFP+BirA.wtKap1 4 - BAP. GFP+BirA.mutKap1 NS BAP-GFP BAP-HP1 BAP.Kap1 + BirA.HP1g system PentaHis-HRP BAP-KAP1 1,3,5,7 - BAP.wtKap1 2,4,6,8 - BAP.mutKap1 BAP-KAP1 Streptavidin-HRP - Competitor + KAP1mut + KAP1wt - Biotin

  28. a-His-HRP Streptavidin-HRP a-His-HRP Streptavidin-HRP + - + - + - + - + - + - + - + - - + - + - + - + - + - + - + - + + + - - + + - - + + - - + + - - - - + + - - + + - - + + - - + + 1 2 3 4 5 6 7 8 BAP-HP1g BAP-HP1g 1 2 3 4 Expt1 Expt2 BAP-CenpA 0.8 aHis-HRP BAP-H3.1 0.6 BAP-CenpA Streptavidin-HRP BirA: PCNA/GFP 0.4 BAP-H3.1 + + - - BirA-GFP 0.2 - - + + BirA-PCNA + - + - BAP-H3.1 H3.1 H3.1 CenpA CenpA 0 BAP-CenpA BAP: A B 1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8 NS NS BAP-GFP BAP-TAP54a NS BAP-HP1 BirA-TAP54 BirA-KAP1BDwt BirA-HP1 BirA-KAP1BDMut BAP-TAP54 BAP-HP1 BAP-HP1 BAP-GFP 1 2 3 4 5 6 NS BAP-KAP1 a-His-HRP BAP-TAP54a NS NS BAP-KAP1 Streptavidin-HRP - + - - + - BirA-TAP54 • - + • - + BirA-HP1 - + + - + + - Competitor BAP-TAP54 + KAP1mut + KAP1wt - + + - + + - Biotin BAP-HP1 C BirA-PCNA + BAP-H3.1 BirA-PCNA + BAP-CenpA - + - + Biotin DIC

  29. Proximity-Utilizing-Biotinylation (PUB) for study interactions between known interaction partners • Advantage of PUB • Possibility to use mass spectrometry instead of western blotting to detect biotinylation • Can use multiplexing • Can use stable isotopes

  30. B H2Az BAD 100% % of biotinylation 50% 1 2 3 4 Structure of different types ofBAD domains Linear region Interaction strength BAD BAD1070: M GH H H H H H HG L TRI L E A QKI VRG G L E BAD1118: M GH H H H H H HG L TRI L E A QKI FRG G L E BAD1135: M GH H H H H H HG L TRI L E A QKIYRG G L E trypsin 30

  31. MRM of ions with m/z 648 and 563 BAD1070 Biotinylated BAD1070 Propionylated P B b-seria I L E A QKI VR I L E A QK IVR y-seria N-terminus С-terminus N-terminus С-terminus Р B BAD 1070 BAD 1070

  32. MRM of ions with m/z 672 (BAD1118) and 680 (BAD1135) BAD1135 Biotinylated BAD1118 Biotinylated 1185.7 B B I L E A QKI YR I L E A QK I FR H2A.BirA + H2AZ.BAD Streptavidin-HRP Anti-His-HRP 2 3 1 3 2 1 2 3 1 3 2 1 2 3 1 Ubi-b-H2AZ Ubi-b-H2AZ b-H2AZ b-H2AZ Input FlowThrough Elution FlowThrough Elution 32

  33. b6 b8 b7 b2 b4 b3 I L E A Q K(Pr) I V R y3 y2 y4 y7 y6 y5 y8 Intens. 7 y7 x10 +MS2(563.2), 6.2min y6 1.0 y2 y4 y5 b2 b8 y3 b7 b4 y8 b3 b6 0.0 m/z 400 600 800 1000 200 b6 b8 b7 b2 b4 b3 I L E A Q K(Biot) I V R y3 y2 y4 y7 AGAATCCTGGAAGCTCAGAAGATCGTGAGAGGAGGCCTCGAG… R I L E A Q K I V R G G L E y6 y5 y8 BAP1070 Intens. 5 b8 y6 AGAATCCTGGAAGCTCAGAAGATCTTCAGAGGAGGCCTCGAG… R I L E A Q K I F R G G L E x10 BAP1118 +MS2(648.8), 6.6min y3 y2 y4 y7 2.0 b7 AGAATCCTGGAAGCTCAGAAGATCTACAGAGGAGGCCTCGAG… R I L E A Q K I Y R G G L E b2 BAP1135 y8++ y5 b6 y6++ 1.0 b3 b4 y8 0.0 400 600 800 1000 m/z 200 b a c Experimental scheme c. Incubation on Ni2+-NTA agarose a. 4hr biotin pulse before harvest CMV.H2Az.BAP1070 pOz.H2A.BirA CMV.H2Az.BAP1118 c. Wash, ON trypsin and LC-MS/MS b. Mix 3 samples CMV.H2Az.BAP1135 d e M In FT El In FT El BAP1070 propionylated MS2(563.2) BAP1070 biotinylated MS2(648.8) Ub-H2AZ BAP1118 propionylated MS2(587.2) H2AZ BAP1118 biotinylated MS2(672.8) Coomassie Blue Streptavidin-HRP BAP1135 propionylated MS2(623.3) Ni-NTA purification BAP1135 biotinylated MS2(708.4) Figure 3 2 4 6 8 10 12 Time [min]

  34. Identification of Light and Heavy peptides y7 HEAVY propionylated peptide from BAD1070 LIGHT biotinylated y6 y4 y3 y2 b8 b7 y5 HEAVY propionylated y7 LIGHT propionylated peptide from BAD1070 LIGHT Propionylated 10’ biotin pulse y6 y5 y3 b8 y2 b7 y4

  35. Analysis of a specific sub-population of BAP-fusion UV 20 J/m2 Streptavidin pulldown 5 min biotin Elu BirA-POLH + BAP-PCNA FT 48 hr 6 hr B BirA-POLHwt BirA-POLHwt BirA-GFP Bir-AGFP UT Ub-BAP-PCNA BAP-PCNA PCNA 1 2 3 4 5 FT Elu A C 1 2 3 4 5 6 7 8 9 10 6XHis-HRP + + + + + + - + - + UV Ub-BAP-PCNA BAP-PCNA BirA-GFP BirA-PolHwt BirA-POLHΔΔ aPCNA - - - + + BirA-POLHwt - - - - + BirA-POLHΔΔ - - - - + BirA-POLH.PIP - - - - + BirA-POLH.UBZ - + + + + BAP-PCNA - + - - - BAP-PCNAmut

  36. 3- PUB-NChIP Proximity Utilizing Biotinylation (PUB) & Native Chromatin Immunoprecipitation (NChIP) Current Approaches to Study Histone PTMs in Proximity to DNA Damage & Repair Classic ChIP using DDR implicatedchromatinprotein NChIP using α-Histone PTM No need to crosslink use the DNA-histone interactions Crosslinking is necessary Protein part is damaged Any DNA couldbedamaged PUB-NChIP In Vivo biotinylation approach to study chromatin in proximity of a protein of interest

  37. 3- PUB-NChIP ProximityUtilizing Biotinylation (PUB) Biotin BirA .. .. BirA .. .. .. .. .. .. .. .. .. .. .. .. .. BAP .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. BirA: Biotin Ligase .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. BAP: Biotin Accepting Peptide .. .. Y Y Y .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. .. BAP .. .. .. .. X X X Kulyyassov A, Shoaib M, et al. J Proteome Res. 2011 Sep 2 PUB-NChIP BirA.X BAP.Histone (Biotinylated) .. Biotinylated chromatin can be purified BirA.X Cotransfection with BAP.Histone Histone Biotin

  38. - - - - + + + + PUB-nChIP 3- PUB-NChIP Rad18 Proximal ChromatinisSpecificallyBiotinylated BirA.Rad18 + BAP.H2A biotin combined αRad18 αHis-HRP HEK – 293T cells αH2A combined biotin Streptavidin HRP - - + + BirA-Rad18 6 h after UVC (20 J/m2) 15 min Biotin Pulse BAP-H3.1 BAP-H2A BirA: Biotin Ligase BAP: Biotin Accepting Peptide

  39. PUB-nChIP 3- PUB-NChIP Chromatin Purification in PUB-NChIP Flowthrough Supernatant Pellet Input Elution MNase EthBrStaining 15 min Biotin Pulse beforeharvesting Harvestcells and prepareNuclei Tri 500 bp Di 300 bp 200 bp Mono MicrococcalNuclease Digestion WB: Streptavidin-HRP 30 kDa BAP.H2A 12 kDa 0.4 M salt extraction of nucleosomes Coomassie Blue Staining 20 kDa BAP.H2A 3h binding of nucleosomes in Sepharose-Streptavidinbeads H3 H2B 12 kDa H2A H4 + Streptavidin Elution of Biotinylated H2A alongwithother histones

  40. α -H3 α - γH2AX PUB-nChIP 3- PUB-NChIP ChromatinPurified by PUB-NChIP isEnriched in ExpectedPTMs BAP-H2A γH2AX biotin combined + BirA-RAD18 HEK 293T cells + - BirA-RAD18 - + BirA-HP1α BirA-HP1α + + BAP-H2A 3 h afterIonizing Radiation (10 Gy) 15 min Biotin Pulse

  41. PUB-nChIP 3- PUB-NChIP PUB-NChIP Reveals a Specific Pattern of H4 Acetylation in Rad18 Proximal Chromatin BirA.GFP cotransfectedwith BAP.H2A control Biotinylateseverything H H L BirA.GFP + BAP.H2A BirA.GFP BAP.H2A BirA.Rad18 BAP.H2A BirA.GFP BAP.H2A SILAC Experimental Design HEK 293T cells GFP Biotin 1 : 1 1 : 1 1 2 MS analysis of Histone H4 peptide 4-17 (GKGGKGLGKGGAKR) H/L ratios HEK-293T cells H/L ratios 1 2 1Ac 2Ac 3Ac 4Ac UM 1- GFP+H2A (H) / GFP+H2A (L) 2- Rad18+H2A (H) / GFP+H2A (L)

  42. PUB-nChIP 3- PUB-NChIP Proximity of BiotinylatedChromatinwith Rad18 isDiminishedafter 6h Chase BirA.Rad18 + BAP.H2A Overlap Rad18 Biotin Pulse BirA.Rad18 Rad18 Biotin Overlap BAP.H3 BAP.H2A 25kDa α6XHis-HRP HEK – 293T cells Chase 25kDa Streptavidin-HRP Chase Chase Pulse Pulse Zoom 6h after UVC (20 J/m2) 15 min Biotin Pulse FixedImmediately PULSE Sample Fixed 6h later CHASE SAMPLE

  43. 3- PUB-NChIP Rad18 Specific Pattern Changes afterProximitywith Rad18 isDiminished SILAC Experimental Design H H L BirA.GFP BAP.H2A BirA.Rad18 BAP.H2A BirA.GFP BAP.H2A Pulse Samples 1 : 1 1 : 1 MS analysis of Histone H4 peptide 4-17 (GKGGKGLGKGGAKR) 2 1 H H 1 : 1 1 : 1 BirA.Rad18 BAP.H2A BirA.GFP BAP.H2A 4 3 Chase samples HEK-293T cells H/L ratios UVC: 20 J/m2 1.4 15 min Biotin Pulse after 6 h of UVC 1 0.6 Pulse samples, Biotinwasremoved, cellswashed and harvestedimmediately 1- GFP+H2A (H) / GFP+H2A (L) 2- Rad18+H2A (H) / GFP+H2A (L) 3- GFP+H2A (H) / GFP+H2A (L) 4- Rad18+H2A (H) / GFP+H2A (L) Pulse 0.2 0 Chase samples, Biotinwasremoved, cellswashed, reincubated in normal medium, harvestedafter 6h 1 2 3 4 Chase 1Ac 2Ac 3Ac 4Ac UM

  44. 3- PUB-NChIP PUB-NChIP to Study Alternative Chromatin States BirA-Rad18 + αRad18 streptavidin Combined BAP-H2AZub BAP-H2ABBD BAP-H2AZ BirA-Rad18 - + - + - - + + BAP-H2AZ Streptavidin HRP BAP-MacroH2A HEK – 293T cells BAP-mH2A Streptavidin HRP BAP-H2AZ BAP-H2ABBD + - - + - - BirA-Rad18 + + - - - - BAP-H2ABBD 6 h after UVC (20 J/m2) 15 min Biotin Pulse - - - + + - BAP-mH2A

  45. 3- PUB-NChIP Pattern of H4 Acetylationnear Rad18 isDifferent in H2AZ ContainingChromatin H H L BirA.GFP BAP.H2A BirA.Rad18 BAP.H2A BirA.GFP BAP.H2A SILAC Experimental Design MS analysis of Histone H4 peptide 4-17 (GKGGKGLGKGGAKR) 1 : 1 1 : 1 H H 2 1 BirA.Rad18 BAP.H2AZ BirA.GFP BAP.H2AZ 1 : 1 1 : 1 3 4 H/L ratios 1- GFP+H2A (H) / GFP+H2A (L) 2- Rad18+H2A (H) / GFP+H2A (L) 3- GFP+H2AZ (H) / GFP+H2A (L) 4- Rad18+H2AZ (H) / GFP+H2A (L) H2A H2AZ HEK-293T cells UVC: 20 J/m2 15 min Biotin Pulse after 6h of UVC 1 2 3 4 1Ac 2Ac 3Ac 4Ac UM

  46. H6 H2 Tumor heterogeneity requires Single-Cell analysis Cellular variability Heritable Nonheritable Stochasticity at the level of individual cells Genetic Epigenetic Parkhomchuk D et al. Use of high throughput sequencing to observe genome dynamics at a single cell level. Proc Natl Acad Sci U S A. 2009 Dec 8;106(49):20830-5 The statistics of distances between successive mutations in experimental samples is compared with simulated random mutations. R1(49) R2(17) R3(24) VMR (Fano factor) – variance to mean ratio H3(81) H4(80) H6(54) H5(83) H1(41) H2(31) 0.6 1.0 1.4 1.8

  47. Use of PUB to study epigenetic variability PUB allows to study the protein of interest at defined time after the interaction took place Pulse labeling with biotin BirA-Emerin + BAP-H2A BirA-Nurim + BAP-H2A biotin Nurim-GFP Emerin-GFP GFP GFP biotin A Biotin GFP DAPI B Pulse – chase setup: Cells are labeled with biotin for 5’, then washed and allowed to enter mitosis The chromatin domains that were proximal to nuclear envelope in the interphase appear as discrete bands on mitotic chromosomes

  48. Acknowledgements Collaborators: Group members: Undine Mechold Martine Comisso Antoine Viens Shoaib Muhammad Evelyne Saade Damien Vertut Arman Kulyyassov Chloe Robin Pasquale Moio Franck Broouillard Patricia Kannouche

More Related