Lucy
Uploaded by
32 SLIDES
981 VUES
360LIKES

The Cell

DESCRIPTION

The Cell . Cell membrane components. Mostly proteins: on the surface  receptor Below the surface  mostly enzymes Across  allows compounds to move in and out of the cell (channels or pumps). The cell needs to absorb and excrete various compounds throughout its life.

1 / 32

Télécharger la présentation

The Cell

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. The Cell

  2. Cell membrane components • Mostly proteins: • on the surface  receptor • Below the surface  mostly enzymes • Across  allows compounds to move in and out of the cell (channels or pumps)

  3. The cell needs to absorb and excrete various compounds throughout its life. These compounds need to pass through the membrane which is made from a phospholipid bilayer The phospholipid bilayer is formed by phospholipid molecules bipolar molecule: the fatty acid side is hydrophobic, the phosphoric side is hydrophilic Factors affecting transport: cell membrane

  4. The membrane is permeable to: H2O Gases (O2, CO2, N2) Lipids Small, neutral molecules (such as urea) The membrane is impermeable to: - Small, charged molecules “large molecules” such as amino acids, glucose and larger  these compounds must go through channels present in the membrane in order to enter or exit the cell

  5. Compound moves from an area of high concentration to low concentration (or concentration gradient) All compounds permeable to the phospholipid bilayer will move this way Factors affecting transport: Chemical gradient

  6. Passive transport • Compounds will move from area of high concentration toward area of lower concentration • No ATP is needed for this type of transport

  7. Compounds move toward the area of lower concentration Compounds permeable to the cell membrane will move through diffusion. (Compounds unable to pass through the membrane will only pass if membrane channels open) Diffusion

  8. Each compound obeys the law of diffusion However, some compounds are unable to cross the cell membrane (glucose, electrolytes…) Water can cross  will enter or exit the cell depending its concentration gradient Note: the cell membrane is a semipermeable membrane Osmosis

  9. Isotonic solution: solution which has the same compound concentration as the cell Hypotonic solution: solution having a compound in lower concentration compared to the cell Hypertonic solution: solution having a compound in higher concentration compared to the cell Solution tonicity

  10. Some compounds are unable to diffuse through the membrane. They will be allow to cross if the membrane has proteins that can bind these compounds and enable to cross toward the area of lower concentration Facilitated diffusion

  11. Figure 4.11a

  12. Active transport • Compounds move from area of low concentration toward area of higher concentration • ATP (energy) is needed  pump

  13. The most common: Na/K pumps  reestablish membrane potential. Present in all cells. Two K+ ions are exchanged with 3 Na + ions ATPase pumps

  14. Phagocytosis

  15. Cell receptors bind to a compound  initiate endocytosis Receptor-mediated endocytosis Figure 4.21c

  16. Nucleus • Contains the chromosomes – 46 in human • Chromosomes are made of DNA wrapped around proteins (the histones)

  17. Cytoplasm – Ribosomes - Golgi apparatus • Cytoplasm = cytosol (water + nutrients + salts) + endoplasmic reticulum (membrane) • Endoplasmic reticulum: can have ribosomes attached to it (rough) or nothing (smooth) • Ribosomes = special structures in charge of synthesizing proteins • Golgi apparatus = special area of the ER where proteins are processed

  18. Mitochondria Lysozomes • Make ATP (the fuel) for the cell • Contains digestive enzymes

  19. Cell skeleton • Tubules • Filaments • Important for cell shape and cell movement

  20. Cell functions • Multiplication  for growth, differentiation and gamete formation • Protein synthesis • Transcription – DNA  RNA • Translation – RNA proteins

  21. Interphase: phase between mitosis • During interphase, the cell grows, functions  G1 • If the cell decides to undergo division (mitosis), it will replicate its DNA first  S phase • Then, it will prepare for mitosis  G2 (during G2 the cell synthesizes the proteins needed for mitosis • When everything is ready, then the cell undergo mitosis.

  22. Cell multiplication • You can watch a few movies on mitosis (no need to remember the names of the various phases) • Just remember that the daughter cells are identical • http://www.youtube.com/watch?v=VlN7K1-9QB0 • http://www.youtube.com/watch?v=CzPGhYiGyZ8 • http://www.youtube.com/watch?v=Ru8zC_JRyTI

  23. Protein synthesis: 2 steps • Step 1: a copy of the gene (located in the nucleus DNA) is made. This copy is a single strand of mRNA = transcription • Step 2: mRNA then, travels to the cytoplasm where it will be read by the ribosomes. The ribosomes will use the code to assemble the various amino acids • http://www.youtube.com/watch?v=41_Ne5mS2ls

  24. Step 2: Translation • The ribosomes use the genetic code in order to know what amino acid to plug in the sequence • The code is the sequence of 3 nucleotides (=codon) on the mRNA • http://www.youtube.com/watch?v=1NkLqjQkGHU

  25. Lets practice • Part of the template strand on the DNA is: • ATGGCCGTATTGCATCCGAGCTGAATT • What will be the mRNA strand produced during transcription?

  26. Lets practice • Part of the template strand on the DNA is: • ATGGCCGTATTGCATCCGAGCTGAATT • WHICH STRAND IS THE CORRECT STRAND? • TACCGGCATAACGTAGGCTCGACTTAA • Or • UACCGGCAUAACGUAGGCUCGACUUAA

  27. This strand travels toward the cytoplasm where ribosomes will translate it. • UACCGGCAUAACGUAGGCUCGACUUAA • The process is rather complex. We just want to understand the principle: • The ribosome will see the first codon UAA and will look for the matching “anticodon-amino acid”. • The genetic code will show which one it is.

  28. UAC-CGG-CAU-AAC-GUA-GGC-UCG-ACU-UAA • Next codon is CGG  Arginine • Next CAU  Histidine • AAC  ? • GUA  ? • GGC  ? • UCG  ? • ACU  ? • UAA  ?

  29. So, why is this important? • Sometimes, mistakes happen. • If the code is wrong, then the amino acid placed in the protein chain is the wrong one  different shape  different function  most frequently loss of function  Mutation! • Cause of cancer, many genetic diseases

More Related