1 / 10

LET THERE BE LIGHT: Quorum Sensing in Bacteria

LET THERE BE LIGHT: Quorum Sensing in Bacteria. Mary Shane Alexandra Fairfield Nick Galt Davida Smyth Vedham Karpakakunjaram Carolyn Wetzel Sarah Prescott Monica GuhaMajumdar. 1. of 10. Why did we choose Quorum Sensing?.

adelgado
Télécharger la présentation

LET THERE BE LIGHT: Quorum Sensing in Bacteria

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. LET THERE BE LIGHT: Quorum Sensing in Bacteria • Mary Shane • Alexandra Fairfield • Nick Galt • Davida Smyth • Vedham Karpakakunjaram • Carolyn Wetzel • Sarah Prescott • Monica GuhaMajumdar 1 of 10

  2. Why did we choose Quorum Sensing? • Wanted a fun, interactive and visual way to teach a complicated system • Covers topics in the NGSS as well as Intro Biology to Microbiology, Genetics and more (we can dream!) • No known Cell Collective simulations or interactive modules for teaching quorum sensing 2 of 10

  3. What concepts they will learn from this • Two-component signal transduction systems • Quorum sensing as a density-dependent phenomenon • Interaction between an inducer and a receptor • External factors affect quorum sensing (genetic regulation) • Positive feedback loop • Deleterious mutations and compensation in communities 3 of 10

  4. Lesson Plan in Brief 4 of 10

  5. The LuxR-LuxI Model Quorum Sensing – Answer Key glucose density CRP Pheromone LuxR LuxI LuxR-LuxR LuxCDABE Luciferase Bioluminescence 5 of 10

  6. Sample Case Study After a long night of working in the lab, Student D was exhausted. Instead of putting the Vibrio culture in the 25°C incubator, they put the culture in the fridge • Run Simulation • Answer questions a) Impact of temperature on bacterial growth b) Impact of temperature on luminescence 6 of 10

  7. 7 of 10

  8. Wild-type LuxR gene >NC_006841 LuxR ATGAACATTAAAAATATAAATGCTAATGAGAAGATAATTGATAAAATTAAAACTTGTAATAATAATAAAGAT >YP_206883.1 LuxR family transcriptional regulator MNIKNINANEKIIDKIKTCNNNKD Mutant LuxR gene >LuxR mutant DNA sequence ATGAACATTAAAAATACAAATGCTAATGAGAAGATAATTGATAAAATTAAAACTTGTAATAATAATAAAGAT >LuxR mutant protein sequence MNIKNTNANEKIIDKIKTCNNNKD Students will have to translate & align the sequences => It’s a missense mutation! 8 of 10

  9. What could we assess? • Their model reconstruction • Their graphs derived from the simulation/data • If they can identify the mutations • Their reflections on the exercise Most importantly! Can they problem solve? 9 of 10

  10. Future Directions • Complete this Project • Test in the Classroom in the next Academic Year • Share and collaborate • Improve (if needed) • Present the results in Virginia , NSTA and other places… 10 of 10

More Related