Get out worksheet from yesterday and Nucleotides

1. Get out worksheet from yesterday and Nucleotides • Combine the nucleotides of your choice to create one strand of DNA • Then create the compliment strand of DNA • Compare your strand to your to your neighbors strand and finish the worksheet.

2. Protein Synthesis Warm Up What is a code? How does a code work? What do you think “genetic code” means?

3. DNA deoxyribose sugar nitrogen bases G, C, A, T T : A C : G double stranded Only found insidethe nucleus RNA ribose sugar nitrogen bases G, C, A, U U : A C : G single stranded Found inside &outside thenucleus RNA vs. DNA

4. Based on what youknow about DNA andRNA, describe what you see happing to the DNA molecule in the imageto the left.

5. Protein Synthesis Protein Making

6. Goal • Understand the Overall process of protein synthesis (transcription + translation) • Know the Roles • DNA • mRNA • tRNA

7. Organelles used in Protein Synthesis

8. Protein Synthesis • is the process (steps) of sharing the information in the genes of DNA out of the nucleus to the ribosomes to create proteins,which createyour traits

9. nucleus Protein Synthesis • Read DNA blueprint • Create a (single strand) mRNA copy • Leave Nucleus • Goes to Ribosome (cytoplasm) • Ribosome reads RNA • tRNA brings amino acid • Ribosome combines amino acids cytoplasm DNA can’t get out! buildproteins mRNA ribosome

10. Draw this in your spiral Cell Ribosome protein DNA mRNA trait nucleus

11. Draw this in your spiral Cell Ribosome protein DNA mRNA trait nucleus

12. Protein Synthesis Story Time It was Christmas time in the land of Celltopia. There was a princess stuck in her Nucastle because of a broken foot. She really wanted a the gift of blonde hair and green eyes, but she would never make it in time to Santa’s Ribo factory!! So she came up with the idea to write her Christmas list down and give it to her guard. The guard took off with her list on his horse to find one of Santa’s elves who worked in the ribo-facotry and he immediately began reading her list and producing her blonde hair present, and green eye present. On Christmas morning the princess woke up and opened her presents, “yay!!!!” she exclaimed, she now had blonde hair and green eyes!!

13. Correctly Match the photos from the story to your diagram. Cell Ribosome protein DNA mRNA trait nucleus

14. From nucleus to cytoplasm transcription translation protein DNA mRNA trait nucleus cytoplasm

15. DNA mRNA First Step - Transcription • Transcribes DNA tomRNA • DNA strand is the template (pattern) • match bases • U : A • G : C • mRNA leavesnucleus into cytoplasm

16. 2nd Step – Translation mRNA to protein • mRNAconverted to protein shapesin the ribosome • Ribosome read 3nitrogen bases at a time • Codon:3 nitrogenbasescreates 1 amino acid • tRNAbrings theamino acid Rib

17. Protein Synthesis = Transcription + Translation https://www.youtube.com/watch?v=gG7uCskUOrA

18. Get out the Diagram from Friday • In your table groups complete the transcription translation diagram

19. Check Point! Match the analogies to the appropriate biological structure. • The Blueprint • The instructions • The reader • The transporter Word Bank DNA tRNA Ribosome mRNA DNA (blueprint) provides the information, the mRNA (instructions) copies the message, the ribosome (reader) de codes the message, and the tRNA(transporter) brings one amino acid to the ribosome over and over again to build a protein.

20. Answer the following questions • Name the two steps of protein synthesis (in order). • What is the role of DNA in protein synthesis? • What is the role of mRNA? • What is the role of tRNA (use the word amino acid &protein)? • How is DNA transcribed? • During translation, how does mRNA produce proteins?

21. Matching bases of DNA & RNA • Double stranded DNA unzips T G G T A C A G C T A G T C A T C G T A C C G T

22. RNA polymerase Matching bases of DNA & RNA A • Match RNA bases to DNA bases on one of the DNA strands • U instead of T is matched to A C U G A G G U C U U G C A C A U A G A C U A G C C A T G G T A C A G C T A G T C A T C G T A C C G T

23. ribosome A C C A U G U C G A U C A G U A G C A U G G C A Matching bases of DNA & RNA • U instead of T is matched to A TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA

24. ribosome A C C A U G U C G A U C A G U A G C A U G G C A cytoplasm protein nucleus trait

25. The mRNA code • For ALL life! • strongest support for a common origin for all life • Code has duplicates • several codons for each amino acid • mutation insurance! • Start codon • AUG • methionine • Stop codons • UGA, UAA, UAG

26. UAC GCA CAU tRNA Met Arg Val How are the codons matched to amino acids? TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA codon anti-codon aminoacid • Anti-codon = block of 3 tRNA bases

27. aa ribosome aa aa aa A C C A U G U C G A U C A G U A G C A U G G C A aa aa aa tRNA aa From gene to protein transcription translation protein DNA mRNA trait nucleus cytoplasm

31. Protein Synthesis Activity!!

32. From gene to protein protein transcription translation