azura
Uploaded by
26 SLIDES
450 VUES
260LIKES

Biology

DESCRIPTION

Biology. Chapter 13: Genetic Technology. Molecular Biology DNA Fingerprint – a sequence of bands that shows a persons DNA sequence How to make a DNA Fingerprint DNA Extraction Cell is opened and the DNA is separated from the other cell parts. 2. Cutting DNA

1 / 26

Télécharger la présentation

Biology

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Playing audio...

  1. Biology Chapter 13: Genetic Technology

  2. Molecular Biology • DNA Fingerprint – a sequence of bands that shows a persons DNA sequence • How to make a DNA Fingerprint • DNA Extraction • Cell is opened and the DNA is separated from the other cell parts

  3. 2. Cutting DNA • DNA is so long we cut it into smaller fragments • Restriction Enzymes – cut DNA at a specific sequence of nucleotides

  4. EcoRI - CTTAA • Ex: ACTGCTTAAGGCATTGCCTTAACAGGCTA • Bam I - CCTAG • Ex: GCTTACCCTAGATGACGTTACTTACAGGC • Hae III - CCGG • Ex: CCGATACGCTCCGGACTACCGGATCCGGAT

  5. 3. Separating DNA • Gel Electrophoresis – a technique for separating DNA • DNA is negatively charged • Load DNA into gel • Apply electric voltage to gel • DNA will move through gel to positive • Smaller DNA fragments move faster and further

  6. How do you end up with different size fragments that are unique to each individual? • Tandem Repeat – region of a chromosome that contains multiple copies of a DNA sequence • The origin and significance of tandem repeats is a mystery • For forensic scientists they offer a means of distinguishing one individual from another through DNA fingerprinting • 30% of human genome is composed of tandem repeats. • Tandem repeats seem to act as filler or spacers between the gene regions of DNA

  7. 7 1 2 4 6 5 3 FROM BLOOD AT CRIME SCENE Fig. 16.7, p. 259

  8. PCR • PCR – Polymerase Chain Reaction – process of making many copies of genes • Heat DNA to separate two strands • As it cools DNA polymerase starts making copies • Repeat this process and end up with millions of copies

  9. Polymerase Chain Reaction (PCR) DNA heated to separate strands DNA polymerase adds complementary strand DNA fragment to be copied PCR cycles 1 2 3 4 5 etc. DNA copies 1 2 4 8 16 etc.

  10. 13-3 Cell Transformation • Transformation – one organism is changed by a gene or genes from another organism • Genetic Engineering – method of cutting DNA from one organism and inserting the DNA into another organism • Recombinant DNA – DNA made by recombining fragments of DNA from different sources • Plasmid • Extra circular DNA found in some bacteria • Very useful for DNA transfer from one organism into another

  11. Process of Transformation • Cut out gene of interest with restriction enzyme • Use same restriction enzyme to cut plasmid • This creates ends on each that will match up • Combine the gene of interest with the plasmid • Place the recombinant DNA into a bacteria cell • Bacteria will replicate this new DNA and make many copies of the gene of interest

  12. 13-4 Applications of Genetic Engineering • When recombinant DNA is put into a host that organism will use the foreign DNA as if it were its own. • Transgenic Organisms – contain functional foreign DNA • Ex. Glowing bacteria

  13. Fig. 16.12, p. 263

  14. Application of DNA Technology • Transgenic bacteria in agriculture • A bacteria on strawberry plants promotes frost damage on leaves. The gene for this protein is removed and frost damage is prevented. • A bacteria that lives in soil and in the roots of plants can be engineered to increase the rate of conversion of atmospheric nitrogen to nitrates, a natural fertilizer, to help cut back on fertilizer use and cost • Transgenic bacteria in industry • Used to clean up oil spills • Extract valuable minerals from ores

  15. Transgenic bacteria in medicine • The production of growth hormone to treat dwarfism • Human insulin used to treat diabetes • Transgenic plants • Have been genetically engineered to resist herbicides, produce internal pesticides or increase their protein production. • Produce rice with vitamin A • In 2000 52% of soybeans and 25% of corn grown in US was genetically modified

  16. Transgenic Animals • Make animals grow faster and produce leaner meat • Trying to produce chickens resistant to bacterial infections that cause food poisoning • Cows produce different human proteins in their milk

  17. Cloning • Clone – genetically identical offspring produced from a single cell • In 1997 Scottish scientist Ian Wilmut cloned first mammal, a sheep named Dolly

  18. 14-3 Human Molecular Genetics • Human Genome Project • Human Genome Project • An international effort to completely map and sequence the human genome • Started in 1990 and completed in 2000 • How did they do it? • First determined markers – a sequence of bases in widely separated regions of DNA • Cut DNA into random fragments • Determined sequences of the fragments • Computers found areas of overlap between the fragments

  19. One surprise was how few genes humans have • Fruit fly – 14,000 • Tiny worm – 20,000 • Human – 25,000 • A human diploid cell contains more than 3 billion base pairs • Only about 2% of the DNA in your chromosomes functions as genes • The average human gene consists of about 3000 base pairs • The largest gene in the human genome has more than 2 million base pairs

  20. Chromosome 22 and 21 were the first 2 human chromosomes sequenced • Chromosome 22 • Contains approximately 43 million base pairs • 545 genes • 1 causes leukemia • 1 neurofibromatosis • Chromosome 21 • Approximately 32 million base pairs • 225 genes • Lou Gehrigs disease (ALS) – loss of muscle control due to destruction of nerves in the brain and spinal cord

More Related