Hash Tables lecture
Hash Tables lecture. Lecture 5. What is a hash table. An array is a set of “elements” where each “element” is referred to by a subscript: Consider array : @array You refer to each element by: $array[$index]; or $array[2] …..
Hash Tables lecture
E N D
Presentation Transcript
Hash Tables lecture Lecture 5
What is a hash table • An array is a set of “elements” where each “element” is referred to by a subscript: • Consider array : @array • You refer to each element by: • $array[$index]; or $array[2] ….. • A hash table, or associative array, however, is more representative of an index, e.g. in a book, where each entry has a “value” and a corresponding “identifier” [key] . • Unlike arrays in the Hash table the identifier are “strings” • Moreover, the identifiers are, by default, unordered. [a sort function is utilised if required]
Declare and define Hash Table • Declare an empty hash table: • %nucleotides (); • To declare and give values you do the following: • %nucleotides = • ( A => Adenine, • T => Thymine, • G => Guanine, • C => Cytosine ); • A is the identifier (key) and Adenine is the value [entry]
Add / delete entries • To add “entries” need to specify the identifier and the Entry. • %oligos = (); • $oligos{’192a8’} = ‘GGGTTCCGATTTCCAA’; • $oligos{’18c10’} = ‘CTCTCTCTAGAGAGAGCCCC’; • $oligos{’327h1’} = ‘GGACCTAACCTATTGGC’; • Note: the identifier must use ‘ ‘; e.g. ‘192a8’ • Removing elements: • Delete $oligos{’192a8’};
Output and Assign “entry” values • hash results • Print the value of the entry: • print “oligo 18c10 is $oligos{’18c10’}\n”; • Assign the entry to a variable • $s = $oligo{’192a8’}; • print “oligo 192a8 is $s\n”; • Determing the size (number of enteries in the table) • $size = keys %oligo; • Print “ the number of enteries are: $size\n”;
Displaying all entries in a hash table • Determine the size of the “value” part of the entry: can prove useful in bioinformatics • print “oligo 192a8 is ”,length $oligos{’192a8’},“ base pairs long\n”; • Input_output_hashtable.pl • Sort and print all the enteries (identifier and value) in the hash table • foreach $genome ( sort keys %gene_counts ) • { • print "`$genome' has a gene count of $gene_counts • { $genome }\n";} • Printing all entries can be done via a while loop [no sorting] • while ( ( my $genome, my $count ) = each %gene_counts) • { • print "`$genome' has a gene count of $count\n"; • } • Refer to genes.pl
Hashes: • A Hash table can be often used like an reference index ; e.g. “code of life” translation table : • hash_base.pl shows what the nucleotide base letter stands for. • Moreover Hash tables could be use, as it the exercise, to create a DNA codon conversion table so that when a codon is encountered as input it converts it to an amino acid; e.g. name, letter …..
Error prevention: exists • It is important to try and prevent errors occurring; such as entering a key that is not in the table. • if this happens you need to effectively deal with it by using the exists function. • The function returns a value of true if the entry is there or false it is not. • if (exists $nucleotide_bases{$_}) • { • print “exists\n”; • } • else • { • print “does not exis\nt”; • } • hash_base_ErrorPrevention.pl
Sample question: translator • Create a hash table for converting DNA condons (3 bases) into amino acids • Display all the enteries to the user • Continually sskthe user to entered three bases and display the corresponding Amino Acid (AA); e.g. aug met…. Repeat the process until a “stop” codon is entered. Display the AA sequence, as single characters, that was [entered as bases by the user]; note: you must use another has table for this part.