1 / 21
Télécharger la présentation

Hemoglobin Beta-subunit (HBB)

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Hemoglobin Beta-subunit (HBB) Josh Bram and Wilton Smith

  2. What is Hemoglobin? • Oxygen (and CO2) transporter for all vertebrates • Tetramer composed of four protein subunits (two alpha and two beta subunits) • Four Iron-containing haeme centers carry one oxygen molecule each • Beta-subunit mutations cause: • Sickle-cell anemia • Beta-thalessemia • 146 amino acid protein subunit

  3. Hemoglobin - β Mutation Diseases Sickle Cell Anemia Beta Thalassemia Either a decrease or absence of beta-globin production Prevents Red Blood Cells from having enough Hemoglobin to supply oxygen to the body In mice, leads to sickly and weak individuals, or stillborn offspring • Mutation causing beta-globin units to stick together in masses and deform Red Blood Cells • RBCs take crescent shape and have many consequences • These include premature death and blocking of small blood vessels

  4. Peromyscusleucopus

  5. Primer Design • Targeted Intron 2 (~700 base pairs) • Forward Primer (E2E3F): 5’ ctccatgtggatcctgagaac 3’ • GC%: 52.38 • 21 base pairs • Melting point: 55° C • Reverse Primer (E2E3R): 5’ acgatcatattgcccaggag 3’ • GC%: 50.00 • 20 base pairs • Melting Point: 55° C

  6. DNA Extraction • QiagenDNeasy Blood & Tissue Kit • Two samples of P. leucopus extracted • Sample 1 extracted after 20 minute incubation • Sample 2 extracted after extended incubation • Both DNA samples yielded amplification results at one time or another; however, sample 2 proved to be a more reliable DNA source

  7. Polymerase Chain Reaction (PCR) • 6.25 μL Mastermix • Mix composed of parts: • 50 x 1.25 μL 10x buffer = 62.5 μL • 50 x 1.25 μLdNTP = 62.5 μL • 50 x 0.1 μL TaqPolymerase = 5 μL • 4.25 μL dH2O • 1.00 μL DNA • 0.50 μL PF • 0.50 μL PR

  8. Initial Identification • Six sample PCR • Sample DNA 1 at 50˚C, 55˚C, and 60˚C • Sample DNA 2 at 50˚C, 55˚C, and 60˚C • Successful gene amplification for Sample DNA 2 at 60˚C PCR (well seven) 2 kb 1.5 kb 1 kb 700 bp 500 bp 300 bp 100 bp

  9. What happened? • Only Sample DNA 2 used for future PCR reactions • Gene amplification failed to occur at 60˚C (or any temperature) • Possible errors in PCR mix setup, PCR machine setup, random error, denatured primers

  10. Successfully Identified 1, 1.5, and 2x primer concentrations all show amplification at approx. 700 bp • PCR run at multiple primer concentrations (1X, 1.5X, 2X) for Sample DNA 2 • Successful gene amplification for across all primer concentrations (wells two, three, and four)

  11. Initial 50 μL PCR products • 50 μL PCR reactions for eventual sequencing • All PCR ingredient volumes multiplied by four for 50 μL PCR • Wells two and three show the HBB PCR products (1X and 1.5X Primer concentrations) HBB PCR Prodcuts, approx. 700 bp

  12. PCR Product Cleanup for Analysis • Used Qiagen PCR Purification Kit • Cleanup up PCR Product to send for sequencing • Sent 5 μL of each primer, 10 μL of PCR product • Sent to Penn State sequencing facility in Chandlee building

  13. HBB Sequence

  14. HBB Forward Primer • Compared to Mussequence

  15. HBB Reverse Primer • Compared to Mussequence

  16. BLAST Results

  17. Population Samples • Six Population Sample PCR at 60˚C • TK20806 • TK20808 • TK20809 • TK20813 • TK20852 • TK20857 • All samples showed gene amplification East West

  18. 5E (806) vs 9W (852)

  19. Conserved vsUnconserved

  20. Site 179 Depending on reading frame: Cys to Tyr, Val to Met, Leu to Leu

  21. Bibliography • http://www.uniprot.org/uniprot/P68871 • http://ghr.nlm.nih.gov/gene/HBB • http://biotools.umassmed.edu/bioapps/primer3_www.cgi • http://www.ncbi.nlm.nih.gov/genbank/ • http://www.megasoftware.net/ • http://nucleobytes.com/index.php/4peaks • http://bioinformatics.picr.man.ac.uk/research/software/tools/sequenceconverter.html

More Related