Download
slide1 n.
Skip this Video
Loading SlideShow in 5 Seconds..
eGFP PowerPoint Presentation

eGFP

154 Vues Download Presentation
Télécharger la présentation

eGFP

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. BamHI KpnI SalI MluI PstI BglII ggatccggtaccgtcgacacgcgtctgcagagatct eGFP 35S 35S HYG(R) ΔpCAMBIA1302 pVS1 Sta (10590 bp) Kan (R) pVS1-REP Supplemental Figure S8. Modified pCAMBIA1302 vector.