eGFP

Sep 25, 2014

20 likes | 262 Vues

BamHI KpnI SalI MluI PstI BglII. ggatccggtaccgtcgacacgcgtctgcagagatct. eGFP. 35S. 35S. HYG(R). Δ pCAMBIA1302. pVS1 Sta. (10590 bp). Kan (R). pVS1-REP. Supplemental Figure S8. Modified pCAMBIA1302 vector.

drea

Télécharger la présentation

eGFP

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

BamHI KpnI SalI MluI PstI BglII ggatccggtaccgtcgacacgcgtctgcagagatct eGFP 35S 35S HYG(R) ΔpCAMBIA1302 pVS1 Sta (10590 bp) Kan (R) pVS1-REP Supplemental Figure S8. Modified pCAMBIA1302 vector.