1 / 10

“Fuel it up” Team members: Parul Sirohi Sanju Timilsina

Over expression of Acetyl- CoA carboxylase (ACC ) sub-unit accC in E.coli to enhance fatty acid ( triacyl glycerol) accumulation for Bio-fuel production”. “Fuel it up” Team members: Parul Sirohi Sanju Timilsina. Introduction Biochemical pathway.

edita
Télécharger la présentation

“Fuel it up” Team members: Parul Sirohi Sanju Timilsina

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Over expression of Acetyl- CoA carboxylase (ACC) sub-unit accCin E.coli to enhance fatty acid (triacyl glycerol) accumulation for Bio-fuel production” “Fuel it up” Teammembers: ParulSirohi SanjuTimilsina

  2. Introduction Biochemical pathway • The gene of interest in this project is accC ( Acetyl Co-A carboxylase biotin carboxylase).This gene catalyze the formation of malonyl-CoAsubstrate for biosynthesis of fatty acid synthesis. • ACC is a multi subunit( accA, accB, accC and accD) enzyme in most prokaryotes. It is also found in the chloroplast of most of plant and algae. • Fatty acid is the major prerequisite for bio-fuel production, so its over production might enhance bio-fuel production. • Overexpression of the enzyme DGAT is most likely to enhance lipid, Tri-acyl glycerol over production but due to high introns numbers in the source ( Arabidopsis thaliana) we chose ACC over DGAT. Source: NMD courchesne et.al./ journal of biotechnology 141(2009)31-41

  3. Brief overview Source Organism: E. coli 0157:H7 Source: Biology department of University of Northern Iowa Media: Luria Broth Gene: Acetyl CoA carboxylase biotin carboxylase (accC) Assembly #: NC_011353.1 Region: 4242644..4243993 bp:1350 Introns: none ( prokaryote) Bio-brick Compatibility: Compatible

  4. PCR Primer Sequence for accC gene Primers: • 24F_Biofuel1P 5’gaattctctagaatgctggataaaattgttattgccaaccgc 3’ • 24RP_Biofuel2S 5’ctgcagactaga cgagttttttctccagatagtggatgttagtgc3’ • 24F_Biofuel1 5’ atgctggataaaattgttattgccaaccgc 3’ • 24RP_Biofuel2 5’ cgagttttttctccagatagtggatgttagtgc3’

  5. Gene sequence with primers: Forward primer: 5’gaattctctagaatgctggataaaattgttattgccaaccgc 3’      1 atgctggataaaattgttattgccaaccgcggcgagattgcattgcgtattcttcgtgcc      61 tgtaaagaactgggcatcaagactgtcgctgtgcactccagcgcggatcgcgatctaaaa     121 cacgtattactggcagatgaaacggtctgtattggccctgctccgtcagtaaaaagttat     181 ctgaacatcccggcaatcatcagcgccgctgaaatcaccggcgcagtagcaatccatccg     241 ggttacggcttcctctccgagaacgccaactttgccgagcaggttgaacgctccggcttt     301 atcttcattggcccgaaagcagaaaccattcgcctgatgggcgacaaagtatccgcaatc     361 gcggcgatgaaaaaagcgggcgtcccttgcgtaccgggttctgacggcccgctgggcgac     421 gatatggataaaaaccgtgccattgctaaacgcattggttatccggtgattatcaaagcc     481 tccggcggcggcggtggtcgcggtatgcgcgtagtgcgcggcgacgctgaactggcacaa     541 tccatctccatgacccgtgcggaagcgaaagctgctttcagcaacgatatggtttacatg     601 gagaaatacctggaaaatcctcgccacgtcgagattcaggtactggctgacggtcagggc     661 aactctatctatctggcggaacgtgactgctccatgcagcgccgccaccagaaagtggtc     721 gaagaagcaccagcaccgggcattaccccggaactgcgtcgctacatcggcgaacgttgc     781 gctaaagcgtgtgttgatatcggctatcgcggtgcaggtactttcgagttcctgttcgaa     841 aacggcgagttctatttcatcgaaatgaacacccgtattcaggtagaacacccggttaca     901 gaaatgatcaccggcgttgacctgatcaaagaacagctgcgtatcgctgccggtcaaccg     961 ctgtcgatcaagcaagaagaagttcacgttcgcggccatgcggtggaatgtcgtatcaac    1021 gccgaagatccgaacaccttcctgccaagtccgggcaaaatcacccgtttccacgcacct    1081 ggcggttttggcgtacgttgggagtctcatatctacgcgggctacaccgtaccgccgtac    1141 tatgactcaatgatcggtaagctgatttgctacggtgaaaaccgtgacgtggcgattgcc    1201 cgcatgaagaatgcgctgcaggagctgatcatcgacggtatcaaaaccaacgttgatctg    1261 cagatccgcatcatgaatgacgagaacttccagcatggtggcactaacatccactatctggagaaaaaactcggtcttcaggaaaaataa3’Cgtgattgtaggtgatagacctcttttttgagcagatcagacgtc5’ Reverse Primer

  6. Vector Plasmid pSB1A3 pSB1A3 is a high copy number plasmid carrying Ampicillin resistance pSB1A3 is a bio-brick compatible plasmid that has prefix(E-X) and suffix(S-P) once in the whole sequence Its is also compatible for the constitutive promoter family member

  7. Promoter/Regulator • Part: BBa_J23100 • Constitutive promoter family member is the consensus promoter sequence and is the strongest member of the family • RFP(au) of the J23100 is 2547 fold more than in wild type, which means it has 2547 fold more ability to increase enzymatic activity of enzyme in the biochemical pathway • Sequence: ttgacggctagctcagtcctaggtacagtgctagc • Alternative Promoters: • J23113:RFP- 21 ctgatggctagctcagtcctagggattatgctagc • J23109:RFP-106 tttacagctagctcagtcctagggactgtgctagc

  8. Steps • Grow the source organism (E. coli) in LB media • DNA extraction from the source (E. coli) • Electrophoresis to check desired DNA segment (bp) • Primer designing • Multiplication of gene of interest by PCR • Electrophorosis • Digestion of Plasmid by restriction enzymes ( cut plasmid with S+P i.e bp2 and gene of interest with X+P i.ebp 2149 and P at bp20 ) • Ligation of accC gene in plasmid vector (pSB1A3) • Transformation of vector plasmid into host organism E. coli • Cloning of cells in a LB media • Selection for recombinant DNA colonies by antibiotic selective media (LB+ ampicillin) • Inoculation of E.coli in biomass • Testing of fatty acid (tri acyl glycerol) by thin layer chromatography -Materials for TLC: Silica gel, -Solvent mixture hexane/diethyl ether/acetic acid(17/3/0.2/v/v/v) -CuSO4 reagent ( 20g CuSO4, 200ml methanol, 8ml H2SO4 and 8ml H3PO4)) -acetone/ toluene/ water( 91/30/8,v/v/v)

  9. References • Magnuson, K., Jackowski, S. Rock,C.O., and Cronan, J.E.1993.Regulation of fatty acid biosynthesis in Escherichia coli. Microbial Rev.57(3):522 • NoemieManuelle Dorval Courchesne, Albert Parisien, Bei Wang, Christopher Q. lan 2009 Enhancement of lipid production using biochemical, genetic and transcription factor engineering approches, Journal of botechnology • http://partsregistry.org/Main_Page • http://www.ncbi.nlm.nih.gov/ • http://scholar.google.com/

  10. Goal: To overexpressed accC gene in E.coli to increases Tri acyl glycerol (TAG) production then our future goal will be to express the accC gene in any possible microorganisms ( Algae and bacteria) which might enhance lipid production in waste biomass.

More Related