Download
real time pcr n.
Skip this Video
Loading SlideShow in 5 Seconds..
REAL-TIME PCR PowerPoint Presentation
Download Presentation
REAL-TIME PCR

REAL-TIME PCR

262 Vues Download Presentation
Télécharger la présentation

REAL-TIME PCR

- - - - - - - - - - - - - - - - - - - - - - - - - - - E N D - - - - - - - - - - - - - - - - - - - - - - - - - - -
Presentation Transcript

  1. REAL-TIME PCR APPLICATION PRINCIPLE INSTRUMENTATION INSTRUCTOR: EDDIE WAMPANDE

  2. Rochelightcycler480 Application of LC • Instrumentation • Plate holder • LED lamp • CCD camera • Computer—process the data- EXO • Absolute quantification of Nucleic acid • Melting curve (SNP analysis) Tm • Gene scanning Requirements IXO files • Primers • Probes (flourecsently labeled) • 640 red dye

  3. Types of probes • Taqman probes • Hydrolysis probes • Hybridization probes……………..

  4. Hybridization probes

  5. Showing the SNPs Distinguishing MTB Uganda genotype from other genotypes using SNP assays Hershberg et al, 2008

  6. Principle of genotyping using hybridization probes • Probes designed to identify wild type (non-Uganda genotype, no SNP leads to perfect match). • Uganda genotype Presence of SNP, there is a mismatch.

  7.   >Rv004c (DNA) unknown function • ATGATCCAGATCGCGCGCACCTGGCGGGTCTTCGCAGGCGGCATGGCCACCGGTTTCATCGGCGTGGTGCTGGTCACCGCCGGGAAGGCCTCAGCGGATCCCCTGCTGCCACCGCCGCCTATCCCTGCCCCAGTCTCGGCGCCGGCAACAGTCCCGCCCGTGCAGAACCTCACGGCGCTTCCGGGCGGGAGCAGCAACAGGTTCTCACCGGCGCCAGCACCCGCACCGATCGCGTCGCCGATTCCGGTCGGAGCACCCGGGTCCACCGCTGTGCCCCCGCTGCCGCCGCCAGTGACTCCCGCGATCAGCGGCACACTTCGGGACCACCTCCGGGAGAAGGGCGTCAAGCTGGAGGCACAGCGACCGCACGGATTCAAGGCGCTCGACATCACACTGCCCATGCCGCCGCGCTGGACTCAGGTGCCCGACCCCAACGTGCCCGACGCGTTCGTGGTGATCGCCGACCGGTTGGGCAACAGCGTCTACACGTCGAATGCGCAGCTGGTGGTGTATAGGCTGATCGGTGACTTCGATCCCGCTGAGGCCATCACACACGGCTACATTGACAGCCAGAAATTGCTCGCATGGCAGACCACAAACGCCTCGATGGCCAATTTCGACGGCTTTCCGTCATCAATCATCGAGGGCACCTACCGCGAAAACGACATGACCCTCAACACCTCCCGGCGCCACGTCATCGCCACCTCCGGAGCCGACAAGTACCTGGTTTCGCTGTCGGTGACCACCGCGCTGTCGCAGGCGGTCACCGACGGGCCGGCCACCGATGCGATTGTCAACGGATTCCAAGTGGTTGCGCATGCGGCGCCCGCTCAGGCGCCTGCCCCGGCACCCGGTTCGGCACCGGTGGGACTACCCGGGCAGGCGCCTGGGTATCCGCCCGCGGGCACCCTGACACCAGTCCCGCCGCGCTAG   • Forward primer • ATT GCT CGC ATG GCA GA • Reverse primer • AAA CCA GGT ACT TGT CGG • Probe 1 • LC Red 640 -TGA TGA CGG AAA GCC GTC GAA A-Phosphate • Probe 2 • GTT TTC GCG GTA GGT GCC CTC GAT G-Fluorescein • Condition for designing primer/probes • As for primers • Size of amplicon.. (100-300 bp) • Distance between probes (2bp) • 3’- is phosphrylated • The dye is put at the 5’ end

  8. Procedure in the Lightcycler • Extracted genomic DNA by heating the MTB in PCR water followed by centrifugation. • Make many copies of the target region by PCR. • Allow the probes to hybridize, Melting curve step and observe for the melting temperature . • High Tm= wild type. • Lower Tm= Uganda genotype.

  9. Genotyping MTB by SNP analysis • Mix the reagents as for PCR and include the probes Steps • Amplification– Normal PCR say 35 cycles • Melting curves (to allow the probes hybridize onto the amplicon & later melt off) • The difference in Melting temperature will determine the presence of SNP • High Tm, due to perfect match= Wild type, No SNP (non-Uganda genotype) • Lower Tm, because of mismatch= Mutant, presence of SNP (Uganda genotype)

  10. Thank you very much