1 / 22

Real Time PCR

FAM. TAMRA. Real Time PCR. Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format. Calibration System. FAM. Detection Sequence 5’ AGTATTCATCCACAATTTT A AAAGAAAAGGGGGGAT TGGGGGGT ACAGTGCAGGGGAAAGAAT 3’ Calibration Sequence

xanthus-mason
Télécharger la présentation

Real Time PCR

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. FAM TAMRA Real Time PCR Production at FIOCRUZ in GMP condition of Enzymes, Primers and Probes, Mater mix in ready to use format.

  2. Calibration System FAM Detection Sequence 5’ AGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAAT 3’ Calibration Sequence 5’ AGTATTCATCCACAATTTTAAAAGGGGGAAAAGGATTGGGGGGTACAGTGCAGGGGAAAGAAT 3’ VIC FAM HIV VIC PET ou TAMRA FAM VCA HCV

  3. Results Calibrator Standart curve FIOCRUZ - PATENT

  4. FIOCRUZ NAT Platform Bio-Manguinhos/IBMP • Detection • Extraction • PCR Setup • HTP • LTP

  5. Liquid Microarrays for Diagnosis

  6. Liquid Microarrays

  7. Liquid Microarrays

  8. Reporter Fluorescence Green laser Bead Fluorescence Red laser Liquid Microarrays

  9. Pilot project multi-test

  10. Different Trypanosoma cruzi antigen preparations

  11. Trypanosoma cruzi ORFeome • 23,083 “genes” (GenBank, Jul 2009) • Highly redundant, estimated to be ~12,000 distinct gene loci • Few gene families account for a large proportion of genes (6 families, 4967 “genes”, 21% of gene content) • The repetitive nature of the genome makes assembly difficult. As a consequence, the ORF definition is worse than for other organisms. • Related organisms, as Leishmania sp. and T. brucei, have about 8,000 genes, which is a good estimation for the lower limit of T. cruzi genes.

  12. Trypanosoma cruzi ORFeome Institute Carlos Chagas/FIOCRUZ ORFeome (Wikipedia) Orfeome is the totality of open reading frames(ORF) from one organism. ORFs are the most important genetic elements in genomes as they code for proteins Genome (ORFs) Organism ORFeome (all ORFs in a suitable vector) Suitable Vector (Gateway)

  13. Trypanosoma cruzi ORFeome Institute Carlos Chagas/FIOCRUZ • Pre-processing • Intense bioinformatics analysis, using all ORFs from Kinetoplastida genome projects, to better define the region to be amplified. • Primers are 30mer in average, i.e., US$6/gene 3rd step. Gateway entry BP reaction, US$5/gene 1st step. PCR amplification 2 PCRs per gene, US$3/gene 2nd step. PCR purification Magnetic, US$1/gene 5th step. Plasmid purification Magnetic, US$1/gene 6th step. Plasmid verification PCR, US$ 0,1/gene 4th step. Bacterial transformation, Colony picking and Culture Agar plates, 4 clones/gene, US$0.25/gene

  14. Trypanosoma cruzi ORFeome ICC/FIOCRUZ Completeness Current state (v. 0.2) 40% 20% 20% • 3,840 primer pairs designed and ordered. • 1,920 genes amplified (~85% of them were positive). • ~7,500 clones collected and certified by PCR. Future prospects (6 months, v. 1.0) • 7,680 primer pairs designed and ordered. • Amplification of all analyzed genes. • All clones (~30,000) collected and certified by PCR. • All clones sequenced and certified ORFeome produced. Future prospects (12-18 months, v. 2.0) • Information from other T. cruzi strain will be added and used for covering more ORFs that were excluded or not present in CL Brener.

  15. Trypanosoma cruzi ORFeome Genome (ORFs) Organism Interactome Localizome Suitable Vector (Gateway) HT protein expression Ag-Ab screening Downstream Applications (among many others) ORFeome (all ORFs in a suitable vector)

  16. Antonio G.P.Ferreira Bio-Manguinhos-Fiocruz Bruna P.F.Fonseca, Bio-Manguinhos-Fiocruz Edimilson D.Silva, Bio-Manguinhos-Fiocruz Christiane F.S.Marques Bio-Manguinhos –Fiocruz Alexandre Costa IBMP Viviane Goes IBMP Cristiane Reinarch IBMP Cesar A.B. Duarte, ICC-Fiocruz Leonardo Foti ICC-Fiocruz Christian M.Probst ICC-Fiocruz Daniela Parada Pavoni ICC-Fiocruz Samuel Goldenberg, ICC-Fiocruz/IBMP Marco Aurelio Krieger ICC-Fiocruz/IBMP mkrieger@fiocruz.br

More Related