Obesity

1. HERSHEY, PA—In one of the largest product-liability rulings in U.S. history, the Hershey Foods Corporation was ordered by a Pennsylvania jury Monday to pay $135 billion in restitution fees to 900,000 obese Americans who for years consumed the company's fattening snack foods.

2. Obesity A disease on brain cells that encourage you to EAT Prepared by, ASHRAF

3. Overview • What is Obesity • What causes the disease • Who are obese • Genetic view of obesity • How to cure obesity

4. What is obesity? Obesity is an excess of body fat that frequently in a significant impairment of health • Man with more than 25% fat and woman with more than 30% fat are obese • Obese is a risk factor of chronic diseases: • Heart disease • Diabetes • High blood Pressure • Stroke • Some form of Cancer • It has more than one cause: • Genetic • Environmental • Psychological • Other factors may all play a part.

5. What causes obesity? • Four years ago scientists working with mice discovered a hormone, leptin, which appears to control weight. • LEPTIN, produced by ADIPOCYTES (fat cells), and travels up to the appetite control center in the brain, the hypothalamus. • LEPTIN is thought to act as a LIPOSTAT: as the amount of fat stored in ADIPOCYTES rises, LEPTIN is released into blood and signals to the brain that the body has enough to eat • Therefore, body fat is maintained at a steady level, and makes dieting difficult. The mechanism can be altered, but it is easier to make the body gain weight, than to lose it.

6. What causes obesity? • Most overweight people have high levels of LEPTIN in their body stream; therefore other molecules also effect feeling of satiety and contribute to the regulation of body weight • In a recent study, Gene-Jack Wang, a physician of Brookhaven National Laboratory found that obese people have fewer brain receptors for dopamine, a neurotransmitter that helps produce feelings of satisfaction and pleasure • That implies: obese people may eat to stimulate their underserved reward circuits, just as addicts do by taking drugs

7. Who are obese? • Eight out of 10 people are overweight in USA and 25% completely Sedentary • Half the British population is overweight • In USA: • 58 million Overweight • 40 Million Obese • 3 Million morbidly Obese

8. Who are obese? • Well fit: people who meet basic activity level recommendations • Fit to obese: Somewhere between the range • Extreme obese: people who are inactive or need special care

9. Genetic view of obesity • Ob1.seq -> 492 BP • DEFINITION Gallus gallus leptin (ob) mRNA, complete cds. ACCESSION AF012727 • Ob2.seq -> 504 BP • DEFINITION Sus scrofa leptin (ob) mRNA, complete cds.ACCESSION U59894 • Ob3.seq -> 3800 BP • DEFINITION Homo sapiens leptin receptor (LEPR), mRNA.ACCESSION NM_002303 • Ob4.seq -> 3426 BP • DEFINITION Homo sapiens leptin (obesity homolog, mouse) (LEP), mRNA. ACCESSION NM_000230 • Ob5.seq -> 3393 BP • DEFINITION Mus musculus leptin receptor (Lepr), mRNA.ACCESSION NM_010704 • Ob6.seq -> 561 BP • DEFINITION Mus musculus neuropeptide Y (Npy), mRNA.ACCESSION NM_023456 • Ob7.seq -> 971 BP • DEFINITION Mus musculus adipocyte complement related protein (Acrp30), mRNA. ACCESSION NM_009605 • Ob8.seq -> 3525 BP • DEFINITION Mus musculus leptin receptor (Lepr), mRNA.ACCESSION NM_146146 • Ob9.seq -> 4517 BP • DEFINITION Homo sapiens adipose most abundant gene transcript 1 (APM1), mRNA. ACCESSION NM_004797

10. PublishMus musculus neuropeptide (ob6.seq) . . . . . . . . gtggatctcttctctcacagaggcacccagagcagagcacccgccgctcagcgacgactgcccgcccgccacgatgctag ---------+---------+---------+---------+---------+---------+---------+---------+ V D L F S H R G T Q S R A P A A Q R R L P A R H D A R . . . . . . . . gtaacaagcgaatggggctgtgtggactgaccctcgctctatctctgctcgtgtgtttgggcattctggctgaggggtac ---------+---------+---------+---------+---------+---------+---------+---------+ * Q A N G A V W T D P R S I S A R V F G H S G * G V P . . . . . . . . ccctccaagccggacaatccgggcgaggacgcgccagcagaggacatggccagatactactccgctctgcgacactacat ---------+---------+---------+---------+---------+---------+---------+---------+ L Q A G Q S G R G R A S R G H G Q I L L R S A T L H . . . . . . . . caatctcatcaccagacagagatatggcaagagatccagccctgagacactgatttcagacctcttaatgaaggaaagca ---------+---------+---------+---------+---------+---------+---------+---------+ Q S H H Q T E I W Q E I Q P * D T D F R P L N E G K H . . . . . . . . cagaaaacgcccccagaacaaggcttgaagacccttccatgtggtgatgggaaatgaaacttgttctcccgacttttcca ---------+---------+---------+---------+---------+---------+---------+---------+ R K R P Q N K A * R P F H V V M G N E T C S P D F S K . . . . . . . . agtttccaccctcatctcatctcatcccctgaaaccagtctgcctgtcccaccaatgcatgccaccactaggctggactc ---------+---------+---------+---------+---------+---------+---------+---------+ F P P S S H L I P * N Q S A C P T N A C H H * A G L . . . . . . . . cgccccatttcccttgttgttgttgttgtatatatgtgtgtttaaataaagtaccatgcattcaaaaaaaaaaaaaaaaa ---------+---------+---------+---------+---------+---------+---------+---------+ R P I S L V V V V V Y M C V * I K Y H A F K K K K K K a -

11. Tree View Phylogenic tree: • Ob1 -> Gallus gallus leptin (AF012727) • Ob2 -> Sus scrofa leptin (U59894) • Ob3 ->Homo sapiens leptin receptor (NM_002303) • Ob4 ->Homo sapiens leptin (NM_000230) • Ob5 -> Mus musculus leptin receptor (NM_010704)

12. Pretty Look Plurality: 2.00 Threshold: 1 AveWeight 1.00 AveMatch 1.00 AvMisMatch 0.00 PRETTY of: @/home/amashraf/.seqlab-mango/pretty_53.list April 29, 2003 17:42 .. 1 90 input_53.rsf{ob1} ATGTGCTGGA GACCCCTGTG TCGACTTTGG TCATACCTTG TTTATGTTCA AGCAGTGCCG TGCCAGATCT TCCAGGATGA CACCAAAACC input_53.rsf{ob2} ATGCGCTGTG GACCCCTGTG CCGATTCCTG TGGCTTTGGC CCTATCTGTC CTACGTTGAA GCCGTGCCCA TCTGGAGAGT CCAGGATGAC input_53.rsf{ob6} gtggatctct tctctcacag aggcacccag agcagagcac ccgccgctca gcgacgactg cccgcccgcc acgatgctag gtaacaagcg Consensus ATG-GCTG-- GACCCCTGTG -CGA-TCC-G TG-------C CCTATGTTCA ---AGT-C-G -CCG-GC-C- TC-AGG-TG- C-A--AAGCC 91 180 input_53.rsf{ob1} CTCATCAAGA CCATTGTCAC CAGGATCAAT GACATTTCAC ACACGTCGGT ATCCGCCAAG CAGAGGGTCA CTGGCTTGGA CTTCATTCCT input_53.rsf{ob2} ACCAAAACCC TCATCAAGAC GATTGTCACC AGGATCAGTG ACATTTCACA CATGCAGTCT GTCTCCTCCA AACAGAGGGT CACCGGTTTG input_53.rsf{ob6} aatggggctg tgtggactga ccctcgctct atctctgctc gtgtgtttgg gcattctggc tgaggggtac ccctccaagc cggacaatcc ConsensusA-CA--AC-- TCAT-A--AC CA-T-TCACT A-CATT-CTC ACATGTC-G- -----C---- ----GGGTCA C-C-C--GG- C--C--TTC- 181 270 input_53.rsf{ob1} GGGCTTCACC CCATTCTGAG TTTGTCCAAG ATGGACCAGA CTCTGGCAGT CTATCAACAG GTCCTCACCA GCCTGCCTTC CCAAAATGTG input_53.rsf{ob2} GACTTCATCC CTGGGCTCCA TCCTGTCCTG AGTTTGTCCA AGATGGACCA GACCCTGGCG ATCTACCAAC AGATCCTCAC CAGTCTGCCT input_53.rsf{ob6} gggcgaggac gcgccagcag aggacatggc cagatactac tccgctctgc gacactacat caatctcatc accagacaga gatatggcaa ConsensusGGGCT---CC CCG--CTCAG T-----C--G A-G-T-C--A --CTGGC-G- GAC-CTACAG -TCT-CCA-C ACCTGCC--C CA-A--GC-- 271 360 input_53.rsf{ob1} CTGCAGATAG CCAATGACCT GGAGAATCTC CGAGACCTCC TCCATCTGCT GGCCTTCTCC AAGAGCTGCT CTCTGCCTCA GACCAGTGGC input_53.rsf{ob2} TCCAGAAATG TGATCCAAAT ATCGAATGAC CTGGAGAACC TCCGGGACCT TCTCCACCTG CTGGCCTCCT CCAAGAGCTG CCCCTTGCCC input_53.rsf{ob6} gagatccagc cctgagacac tgatttcaga cctcttaatg aaggaaagca cagaaaacgc ccccagaaca aggcttgaag acccttccat Consensus--GA--AA-G CCA--GACAT -GAGAAT--C C--GA-AACC TCCG--AGCT ---C-ACC-C C-G--CT-CT C---G-G--G -CCCTT-C-C 361 450 input_53.rsf{ob1} CTGCAGAAGC CAGAGAGCCT GGATGGCGTC CTGGAAGCCT CACTCTACTC CACAGAGGTG GTGGCTTTGA GCAGGCTGCA GGGCTCTCTG input_53.rsf{ob2} CAGGCCAGGG CCCTGGAGAC CTTGGAGAGC CTGGGCGGCG TCCTGGAAGC CTCCCTCTAC TCCACGGAGG TGGTGGCCCT GAGCAGGCTG input_53.rsf{ob6} gtggtgatgg gaaatgaaac ttgttctccc gacttttcca agtttccacc ctcatctcat ctcatcccct gaaaccagtc tgcctgtccc ConsensusCTGG-GA-GG CA-AGGA-AC -T-TG----C CTGG--GCC- --CT--AA-C CTCA----A- -TCAC---G- G-A-GC-GC- GGGCTGTCTG 451 540 input_53.rsf{ob1} CAGGACATTC TTCAACAGTT GGATATTAGC CCGGAATGCT GA~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ input_53.rsf{ob2} CAGGGGGCTC TGCAGGACAT GCTGCGGCAG CTGGACCTCA GCCCTGGCTG CTGA~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ ~~~~~~~~~~ input_53.rsf{ob6} accaatgcat gccaccacta ggctggactc cgccccattt cccttgttgt tgttgttgta tatatgtgtg tttaaataaa gtaccatgca Consensus CAGGA-GCTC T-CA-CACTT GG-T-G-C-C C-GGAC-TCT GCC-TG---- ---------- ---------- ---------- ---------- 541 561 input_53.rsf{ob1} ~~~~~~~~~~ ~~~~~~~~~~ ~ input_53.rsf{ob2} ~~~~~~~~~~ ~~~~~~~~~~ ~ input_53.rsf{ob6} ttcaaaaaaa aaaaaaaaaa a Consensus ---------- ---------- - • ob1 = Galus gallus leptin • ob2 =Sus scrofa leptin • ob6 = Mus musculus neuropeptide

13. Compare • Compare between Homo sapiens leptin receptor (ob3) and Mus musculus leptin receptor (ob5)

14. Basic Characteristics of ob4.pep (using seqlab pepsort) Summary for whole sequence: Molecular weight = 120742.11 Residues = 1093 Average Residue Weight = 110.469 Charged = 73 Isoelectric point = 10.45 Extinction coefficient = 195040 Localization potential of ob4.pep (using psortII server) Results of the k-NN Prediction (k = 9/23): 69.6 %: nuclear 8.7 %: mitochondrial 8.7 %: plasma membrane 4.3 %: vesicles of secretory system 4.3 %: cytoplasmic 4.3 %: endoplasmic reticulum Characteristic Properties

15. Distribution of 125 Blast hitson the query sequence of ob3.pep • Blast hits of homo sapiens leptin receptor • 35 of them have score (bits) 2300 – 1000 • Among higher score most of them are of same class.

16. How to cure obesity? • Diets is the only cure of obesity • When diets fail, some people opt for radical surgery. However, this can cause serious problems such as severe diarrhoea, problems with joints, haemorrhaging and scurvy. • In 1994 Phentermine and Fenfluramine were potent and users lost as much as a fifth of their body weight. More than 6 million prescriptions were issued in 1996 alone. • Side effects: It causes a condition known as primary pulmonary hypertension, a constriction of the blood vessels which can cause widespread tissue damage leading to death. • There are no drugs on the market that target the appetite centres of the brain selectively.

17. How to cure obesity? • Dr Arthur Campfield, of Hoffman-La Roche, said: "We believe that there is some place in the leptin receptor that is broken so that obese people have almost no response when we give leptin into the brain." • Fat mice can only be made thin again by forcing them to stop eating. People need a more humane treeatment. • ‘Olestra’ was one of the first products to be included in food to make it "fat free". • Olestra is a fat that cannot be absorbed. However, it causes diarrhoea, and inhibits the absorption of nutrients. • Weight Loss Advice: • If you want to lose weight permanently, your diet program should be directed toward a slow, steady weight loss • According to official government dietary guidelines, you should expect to lose no more than 2 pounds of fat a week • Losing more weight is no guarantee that weight loss is likely to be permanent.

18. References • NCBI • GCG • PubMed • SeqLab • PSORT • ClastalW • BBC • Wellness Intl. Network Ltd

19. Question?

20. Thank you