feryal
Uploaded by
39 SLIDES
656 VUES
410LIKES

Outline

DESCRIPTION

Outline. cDNA library Cloning DNA Amplification Point mutations DNA sequencing Knockout and knockin mice Northern blot In situ hybridization Immunocytochemistry Western blot Immunoprecipitation. DNA. RNA. Protein. cDNA libraries: what’s cDNA?.

1 / 39

Télécharger la présentation

Outline

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Outline • cDNA library • Cloning • DNA Amplification • Point mutations • DNA sequencing • Knockout and knockin mice • Northern blot • In situ hybridization • Immunocytochemistry • Western blot • Immunoprecipitation DNA RNA Protein

  2. cDNA libraries: what’s cDNA? • cDNA libraries: take a brain, chop it up and extract mRNA • You can extract the mRNA by • Pulling it out by its polyA tail • Then synthesize cDNA from the RNA using primer to poly-A motif • cDNA stands for complementary DNA (complementary to the mRNA) Now you need to put the cDNA in a vector for storage.

  3. Cloning Step 1: Make recombinant DNA Recombinant plasmid • Cut vector with restriction enzyme • - Restrictions enzymes usually recognize palindromic sequences of 4 or 6 base pairs • Combine cDNA fragment with linearized vector • Ligation reaction joins sugar backbone of DNA bases together to create “recombinant” DNA

  4. Cloning Step 2: Use bacteria to replicate your DNA for you Ampicillin-resistance gene on the plasmid Recombinant plasmid Step 3: Lyse open the bacteria and take your DNA back

  5. Now you have a library of DNA pieces that came from your Brain of interest… i.e. you have a bunch of bacteria growing on a plate…these bacteria are making copies of the cDNA that you got from the brain and put into plasmids… What if you want to know if “GENE X” was being transcribed In your brain?? Solution: Go fish! Screen the library for your gene by using a DNA probe with a complementary sequence.

  6. Designing the probe • If protein sequence is known, design a DNA probe that corresponds to this sequence

  7. Designing the probe • Can use DNA probe of known sequence to pull out homologous DNA

  8. Screening a library

  9. Cell-Free DNA Amplification - Polymerase Chain Reaction (PCR)

  10. How to Make a Point Mutation TAGTGT 3’ primer ATCACA 5’ primer 1. Design Primers that contain the mutation ATCACA ATCGCA ? Original DNA: CTGATGGATCGCATGTTAGC GACTACCTAGCGTACAATCG

  11. How to Make a Point Mutation TAGTGT +dNTP +DNA polymerase TAGCGT ATCGCA ATCTCA 2. Do a PCR reaction to incorporate mutation ATCGCA TAGCGT TAGTGT 3’ primer Original DNA: CTGATGGATCGCATGTTAGC GACTACCTAGCGTACAATCG ATCACA 5’ primer

  12. How to Make a Point Mutation TAGTGT TAGTGT +dNTP +DNA polymerase TAGCGT ATCGCA ATCGCA ATCACA 2. Do a PCR reaction to incorporate mutation ATCGCA TAGCGT TAGTGT TAGTGT TAGCGT ATCACA ATCACA ATCACA

  13. How do you ensure that the mutation was incorporated? Sequence your DNA

  14. DNA Sequencing

  15. DNA Sequencing Ingredients Template DNA 5’ primer dNTP ddATP ddTTP ddCTP ddGTP Polymerase

  16. DNA Sequencing CGTAA CGTAAC CGTAACC CGTAACCC CGTAACCCT CGTAACCCTT CGTAACCCTTG CGTAACCCTTGG

  17. Knockout and Knockin Mice • Knockout mice allow for specific elimination of a gene of interest • Knockin mice allow for the insertion of a foreign gene into a specific region of the genome • Both techniques rely on homologous recombination for gene insertion

  18. Tricks for making knockouts • Generate a vector containing your DNA of interest, flanked by regions of known homology to your genomic target site • Inside these regions of homology, include a sequence that confers neomycin resistance • Outside of the regions of homology, include a sequence that codes for thymidine kinase • Electroporate vector into ES cells and transplant into blastocysts

  19. Selecting for Recombinant ES Cells

  20. Creating knockout mice for fun and profit Injections to produce superovulation Two days after mating, harvest blastocysts and inject genetically targeted embryonic stem cells X X Inject blastocysts into uterus Pseudo-pregnant female Sterile male

  21. Outline • cDNA library • Cloning • DNA Amplification • Point mutations • DNA sequencing • Knockout and knockin mice • Northern blot • In situ hybridization • Immunocytochemistry • Western blot • Immunoprecipitation DNA RNA Protein

  22. Northern Blotting What it tells you: 1. The size of the RNA transcript 2. The amount of transcript present 3. Whether the transcript is alternatively spliced 4. In what tissue a gene is expressed What it doesn’t tell you: 1. Just because a gene is expressed doesn’t mean its mRNA is translated. Transcript = protein ex. Cells have stores of mRNA transcripts at synapses but the mRNA is not translated until the cell is given the signal.

  23. Northern blot What does a Northern Blot look like? Marker containing transcripts of known molecular weight Alternative splice variant #1 Alternative splice variant #2

  24. Northern blot How do you do it? • Isolate mRNA or total RNA from tissue of interest • Gel electrophoresis (size separation) • Transfer RNA to nitrocellulose blot

  25. Block non-specific sites Incubate with probe or antibody Wash and resolve location of probe What is a blot? Blotting is the process of identifying specific bands of interest amongst all the bands bound to the nitrocellulose. Done with specific probes or antibodies. transfer blot with total RNA, separated by size

  26. What is it? Labeled nucleic acid probes are used to locate specific nucleic acid sequences in situ • When do scientists commonly use it? To demonstrate tissue-specific expression of a given mRNA • Typical Procedure 1. Make RNA probe specific for your transcript 2. Prepare tissue slides 3. Block slides (to prevent non-specific interactions) 4. Incubate slides with labeled probes 5. Visualize location of probe with chemical reaction In Situ Hybridization

  27. In Situ Hybridization What does it look like? Conclusions: In early stages, transcript is distributed throughout the embryo. As the embryo matures, transcript levels remain high but begin to concentrate in the developing nervous system. In the mature embryo, gene expression is restricted to the CNS. Warning: In situ is a qualitative process to visualize gene expression. Do not use it quantitatively.

  28. Outline • cDNA library • Cloning • DNA Amplification • Point mutations • DNA sequencing • Knockout and knockin mice • Northern blot • In situ hybridization • Immunocytochemistry • Western blot • Immunoprecipitation DNA RNA Protein

  29. Western Blotting What it tells you: 1. The size of a protein 2. The amount of protein present (semi-quantitative) 3. In what tissue a protein is expressed What it doesn’t tell you: 1. Whether the protein normally exists as part of a larger complex 2. Subcellular localization of the protein

  30. Western Blot How do you do it? Load protein into gel Need to denature proteins so that they run nicely on the gel Run gel so Proteins separate by size… Smaller runs faster! Then, transfer the protein from the gel onto a nitrocellulose membrane (proteins like to stick to it)

  31. Western Blot Once your protein is stuck to the nitrocellulose membrane, you detect it by using antibodies… Antibody: Definition and Structure Definition: Antibodies are proteins that are secreted by immune system cells (B cells). Function: To recognize and “stick” to antigen. Structure:

  32. Western Blot Incubate membrane with primary antibody Wash Incubate membrane with secondary antibody that is conjugated to an enzyme that makes light, which can be seen on film *

  33. Western Blot What it looks like

  34. Immunocytochemistry What it tells you: Shows subcellular localization of proteins Which cells express that protein Can suggest an interaction What it doesn’t tell you: Very difficult to quantify although people will try

  35. Immunocytochemistry What it looks like Interpretation: Red= protein 1; G= protein 2; Y= overlap of two proteins When 2 proteins are found in the same place, it suggests they may interact, but this is not proof.

  36. Immunoprecipitation (IP) Why do we use it? To capture our protein of interest and look for protein-protein interactions How it works:

  37. Co-Immunoprecipitation (co-IP) 3. G Question: Does Protein B Bind to Protein A?? Immunoprecipitate with Antibody to A and see if it Brings down protein B Protein B Anti-A antibody Control antibody Antibodies stuck to the beads Protein A Protein A Use an antibody to A to confirm it’s there Use an antibody to B to see if it’s there… Protein B Antibodies for visualizing protein Note: This does not prove a direct interaction but it does suggest that the proteins interact in vivo. i.e. is it A-C-B??

  38. What do you do if there are no antibodies specific to your protein?

More Related