gazit
Uploaded by
65 SLIDES
1368 VUES
700LIKES

TRANSLATION

DESCRIPTION

TRANSLATION. Dr.S.Chakravarty MD. Site :-Ribosomes in Cytoplasm . TRANSLATION . Dr.S.Chakravarty , MBBS,M.D . CODONS. A sequence of three nucleotides which together form a unit of genetic code in a DNA or RNA molecule .  SEQUENCE OF THREE NUCLEOTIDES CODING FOR AN AMINO ACID.

1 / 65

Télécharger la présentation

TRANSLATION

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. TRANSLATION Dr.S.Chakravarty MD

  2. Site :-Ribosomes in Cytoplasm

  3. TRANSLATION Dr.S.Chakravarty , MBBS,M.D

  4. CODONS A sequence of three nucleotides which together form a unit of genetic code in a DNA or RNA molecule.  SEQUENCE OF THREE NUCLEOTIDES CODING FOR AN AMINO ACID

  5. Genetic code

  6. Features of Genetic code • Degeneracy – multiple codons must decode same amino acid. • 61 of the total 64 codons – code for amino acids • only 20 aminoacids. • 3 codons – stop codons (UAA, UAG, UGA).

  7. 2. Unambiguous – for any specific codon only 1 aminoacid is indicated. AUG – always codes for methionine. 3. Non-overlapping : AUGUUU – codes for methionine and phenylalanine.

  8. 4. Without punctuations – no spacing or comma between two codons. It is continuous and nonstop from 5’end to 3’end. 5. Universal : triplet codon is the same for a particular aminoacid in all the living species. Exception: mitochondrial DNA varies.

  9. 6. For those amino acids having more than one codon, the first two bases in the codon are usually same. CUU CUC CUA CUG Leucine

  10. Wobble hyothesis • States that rules of base pairing are relaxed at the third position, so that a base can pair with more than one complementary base.  • Some tRNA anticodons have Inosine at the 5’ end.  Inosine can pair with U, C, or A of the 3rd nucleotide of the genetic code. At least one species of t-RNA exist for for each of the aminoacid

  11. 21st and 22nd amino acids • Selenocysteine • Pyrrolysine No genetic code available?

  12. How does amino acids selenocysteine and pyrrolysine gets inserted into protein without genetic code ? • UGA – stop codon • SECIS – SElenoCysteineInsertion Sequence • Present in the 3’UTR region next to stop codon UGA will help the t-RNA to the sequence for selenocysteine. • UAG – stop codon •  PYLIS downstream sequence in 3’UTR sequence

  13. TACGCACATTTACGTACG DNA aa aa aa aa aa aa aa AUGCGUGUAAAUGCAUGC mRNA protein trait Mutations • Changes to DNA are called mutations • change the DNA • changes the mRNA • may change protein • may change trait

  14. What Causes Mutations? • There are two ways in which DNA can become mutated: • Mutations can be inherited. • Parent to child • Mutations can be acquired. • Environmental damage • Mistakes when DNA is copied

  15. Types of mutations • Changes to the letters (A,C,T,G bases) in the DNA • point mutation • change to ONE letter (base) in the DNA • may cause change to protein, may not • frameshift mutation • addition of a new letter (base) in the DNA sequence • deletion of a letter (base) in the DNA • both of these shift the DNA so it changes how the codons are read • big changes to protein!

  16. Point Mutations • One base change • can change the meaning of the whole protein THEFATCATANDTHEREDRATRAN Does this changethe sentence? A LITTLE! THEFATCARANDTHEREDRATRAN OR THEFATCATANDTHEREDBATTAN

  17. Single base changes may be of two types :- • Transition Purine to Purine , Pyr to Pyr • TransversionPurine to Pyrimidine or vice versa

  18. Doesthis changethe protein? DEPENDS…

  19. Effects of single base changes • Silent mutation :- No detectable change . • Generally here the third nucleotide of a codon • Wobble hypothesis • Missense effect :- If a different amino acid is incorporated • Acceptable • Partially acceptable • Unacceptable • Nonsense codon:- Premature termination of the peptide chain

  20. Point Mutations • Silent mutation = no change to protein AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGCUUGCGAGUGA MetArgValTyrAlaCysGluStop

  21. Point Mutations • Missense mutation = changes amino acid AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGUAUGCGAGUGA MetArgValTyrValCysGluStop

  22. Frameshift Mutations • Add or delete one or more bases • changes the meaning of the whole protein THEFATCATANDTHEREDRATRAN THEFATCANTANDTHEREDRATRAN OR THEFATCAANDTHEREDRATRAN

  23. Frameshift Mutations • Addition = add one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGUCAUGCGAGUGA MetArgValTyrValMetArgValA

  24. Frameshift Mutations • Deletion = lose one or more bases AUGCGUGUAUACGCAUGCGAGUGA MetArgValTyrAlaCysGluStop AUGCGUGUAUACGAUGCGAGUGA MetArgValTyrAspAlaSerGA

  25. Cystic fibrosis • Broken salt channel in cells • strikes 1 in 2500 white births • gene codes for a protein channelthat allows salt to flow across cell membrane • broken protein doesn’t work as channel • doesn’t allow salt out of cell, so water doesn’t flow out either • thicker & stickier mucus coating around cells • mucus build-ups in lungs & causes bacterial infections • destroys lung function • without treatment children die before 5; with treatment can live past their late 20s

  26. Effect on Lungs Salt channel transports salt through protein channel out of cell Osmosis problems! normal lungs airway salt salt channel normal mucus H2O cells lining lungs cystic fibrosis salt  thick mucus H2O mucus & bacteria build up= lung infections & damage

  27. Deletion leads to Cystic fibrosis deletion Loss of one amino acid!

  28. NEED A MUTATION FOR SUPERFAST LEARNING !!

  29. Suppressor Mutations Suppressor t RNA molecules are formed as a result of alterations in the anti codon regions capable of suppressing certain missense mutations. They can counteract some effects of mutations. They are abnormal t RNA molecules. Nonsense suppressor t RNA can allow can suppress the normal termination signals to allow an undesirable read through

  30. Structure of t-RNA Antiparallel to the coding sequence of amino acid on the m-RNA. Recognition of t-RNA to the enzyme aminoacyl t-RNA synthatase Binding of aminoacyl-tRNA to ribosomal surface at the site of protein synthesis. Site of attachment of specific amino acid Sequence of code in anticodon arm : 3’-variable base-modified purine-XYZ-pyr, pyr-5’

  31. Activation of t-RNA Step 1: amino acid + ATP → aminoacyl-AMP + Ppi Step 2: aminoacyl-AMP + tRNA → aminoacyl-tRNA + AMP Twenty different aminoacyl t-RNA synthases for twenty different aminoacids

  32. Ribosomes • consist of ribosomal proteins and ribosomal RNAs (rRNAs). • have a large subunit and a small subunit. • The rRNAs provide for important catalytic functions associated with translation.

  33. Figure 15.1

  34. tRNAs • 75–90 nucleotides long and contain posttranscriptionally modifiedbases. • 2-dimensional structure of tRNAs is a cloverleaf.

  35. Modified Bases (unusual bases)

  36. Activation of t-RNA Step 1: amino acid + ATP → aminoacyl-AMP + Ppi Step 2: aminoacyl-AMP + tRNA → aminoacyl-tRNA + AMP Twenty different aminoacyl t-RNA synthases for twenty different aminoacids

  37. Translation of mRNA Can Be Divided into Three Steps • Initiation • Elongation • Termination

  38. Initiation requires: • the small and large ribosomal subunits • mRNA • GTP • charged initiator tRNA • initiation factors

  39. Protein synthesis – Eukaryotes • Initiation • Elongation • Termination • m-RNA is read from 5’ 3’ end. • m-RNA is identified by 18 s RNA through 7 methyl guanosine CAP

  40. Initiation • Formation of 43 s pre-initiation complex: a)First the ribosome dissociates into into 40S and 60S subunits. 40 S subunit 5 3 1A Initiation factors eIF3 and eIF1A and eIF5 bind to the dissociated 40 S unit GTP 2 Binary complex met tRNAi 40 S subunit 5 43 s pre-initiation complex 3 1A 2

  41. Role of eIF-2 α • eIF-2α is regulated by kinases. • Phosphorylation by at least four different protein kinases during stress: • Starvation • Viral infection • Abnormal protein (misfolded proteins) • Hyperosmolarity • Heat shock • Phosphorylated eIF-2α binds tightly to and inhibits eIF-2β which is required for regeneration of GTP from GDP on factor 2 • Insulin increases protein sysnthesis by removing the phosphate and inactivating eIF-2a

  42. 2. Formation of 48s initiation complex 40 S subunit 5 CAP (A)n 3 4F =4E+ 4G4A ATP 1A 2 4F CAP (A)n 4B ATP Cap helps in binding m- RNA to 43S preinitiation complex 4F CAP (A)n M-RNA 4B 4F (A)n CAP 5 3 1A 2 48s initiation complex

  43. Kozak Consensus Sequence is a sequence which occurs on eukaryoticmRNA and has the consensus (gcc)gccRccAUGG. The Kozak consensus sequence plays a major role in the initiation of the translation process

  44. Formation of 80s initiation complex 48s initiation complex 4F 2 Binary complex CAP 5 (A)n 3 GTP 1A 2 2 2B 60 s unit GDP eIF 5 2 (-) AUG CAP (A)n 2α A-site p Met Kozak consensus sequences P-site

  45. Regulation of eIF – 4F • eIF 4E – helps in binding to CAP of m-RNA. It is activated by insulin which phosphorylateseIF 4E. • eIF 4G – CAP independent initiation of translation with the help of eIF 3 – which can be controlled by viruses.

More Related