Transcription and Translation Process Overview
Understand the steps of transcription from DNA to mRNA and the process of translating mRNA into amino acid chains for protein synthesis. Watch video clips, complete practice exercises, and review lab conclusions. Organize binder for grading.
Transcription and Translation Process Overview
E N D
Presentation Transcript
1. Summarize each of the 6 steps of transcription. 2. Make an mRNA copy from the DNA gene: GCATATGCAATGATAGATTGA CGTATACGTTACTATCTAACT 3. How did you know whether the gene was on the top or bottom strand? Bellwork
Grade hmw. • Review the Gel Electrophoresis Lab, complete conclusion, and hand in. (no make-up, go on class website and look up directions for alternative assignment) 3. Binder organization (to be left behind this weekend for grading) 4. Slate review on RNA types & transcription 5. New notes & hand-out on translation NO HOMEWORK. Congrats on finishing science fair project!!! No late boards will be accepted AT ALL after today. Go on the class website to get the alternative assginment (not worth as many points, but you still pass if done well) http://fwsciencejohnson.wikispaces.com
Grade homework: ___/15 • #1 = 3 pts for completion • #2 = 3 pts for completion • #3= 3 pts for completion • #4= all 6 drawings done= 6 pts (at least 3 done= 3 pts)
Look at the gel below • Which colors are negative? Positive? • Which are large? Small? + _
Make a record of what goes where!! • Draw a picture of your gel and indicate where each sample will go (remember there are 8 wells and 6 samples) Measure the distance each dye traveled using the ruler provided. Sample X
Observations • Qualitative Quantitative At least 5 =20 total
Load and run YOUR gels!! • Use the yellow pipettor with a fresh tip to load each dye sample. • Raise your hand to have a biotech student add the buffer when you are done • Connect cables and run the gel at 125 volts for 15 minutes. Note the starting time. • While you wait, make observations and lab notes. (Note any dye spills or over flow. Did your pipettor tip puncture the gel? Can you see any thing happen in the box?) • While you wait, start writing the answers to the questions in complete sentences.
Conclusions—Write these on the back of your DNA lab! • Which dye is the smallest? Largest? Which dyes are positive? Negative? • What dyes make up the unknown (X sample)? • Compare the relative size of one of the positively charged dyes, to one of the negatively charged dyes. Identify dyes in this comparison by number and color. Use the side (+ or -) the dye move towards, and measure the distance from the center for this analysis. • How about your hypothesis?...Was it correct? Why? Hand into box when finished and get out notebook and binder, make sure all notes/hmw. Is finished
Binder Check • On top: • Translation hand-out (from today) • Transcription homework (15)* • Transcription simulation (10) • Transcription In-class practice (10) • History of DNA-scientists (10) • DNA Worksheet (10) • Get slates out • *MUST LEAVE BINDER BEHIND FOR GRADING THIS WEEKEND • Notebook check next week (all even pages filled in, 3 ?s, summary at the bottom)
Protein Synthesis • To get from a DNA gene to a protein, the cell has to perform protein synthesis. • It requires 3 types of RNA: • mRNA • rRNA • tRNA • It happens in 2 parts: • Transcription • Translation
Open binder to Transcription homework. Make SURE YOUR NAME IS ON the homework.Put binder on lab bench in order of last names:
Translation Translation is the process of making an amino acid chain from the instructions coded in the mRNA. Occurs in cytoplasm.
Translation Video Clip • http://www.youtube.com/watch?v=41_Ne5mS2ls (start @ 1:56)
Translation- step 1 Initiation 1. mRNA binds to the ribosome & the ribosome begins reading at the START codonAUG Mature mRNA
Practice GCG AUG CUG GGU CGU UAA Which codon above is the START codon? On your worksheet, find the START codon in each of the 8 mature mRNA strands
Translation- step 2tRNA matching 2. The ribosome move along mRNA & reads each codon, matching it up with a tRNA that has the complementary anti-codon Mature mRNA
Practice What is the anticodon on tRNA that will match with the START codon on mRNA? AUG CCG GCA UGC GGA CUG On your worksheet, fill out the tRNAanticodons for each codon in the mature mRNA strand
Translation- step 3Elongation 3. Each tRNA that enters the ribosome adds an amino acid to the growing chain. A peptide (protein) bond is formed between each amino acid in the chain.
FYI • There are 20 amino acids • Each tRNA can only carry ONE type of amino acid tRNA w/ anticodon “UAC” can ONLY carry methionine (M)
Translation- step 4Termination 3. When a STOP codon (UAA, UAG, or UGA) on mRNA enters the ribosome, the large & small rRNA subunits fall apart and translation ends
Practice How many amino acids are coded for in the mature mRNA strand below? (hint: think about start & stop codons) GAU CUG AUG CCU AAC UGC AUC UAG GCA On your worksheet circle the START codon, Box the STOP codon, and record how many amino acids will be in the chain after translating each of the 8 mRNA strands. STOP (no amino acid) Start: 1 2 3 4 5 What if there are 2 “start” codons?? AUG CGA AUG GAC UGG GAC CCA UAU UAG Start at the FIRST one and keep going until you hit a STOP!
Practice Putting It All Together The central dogma of biology says that ______ RNA Protein Which of the following am I showing/describing? DNA mRNA rRNAtRNA Protein
Practice Putting It All Together Made with Uracil (U) instead of T: ___________ Which of the following am I showing/describing? DNA mRNA rRNAtRNA Protein
Practice Putting It All Together Amino Acids are the small subunits of ___________ Which of the following am I showing/describing? DNA mRNA rRNAtRNA Protein
Practice Putting It All Together Which of the following am I showing/describing? DNA mRNA rRNAtRNA Protein
Practice Putting It All Together Which of the following am I showing/describing? DNA mRNA rRNAtRNA Protein
Practice Putting It All Together Transports amino acids to the ribosome: ___________ Which of the following am I showing/describing? DNA mRNA rRNAtRNA Protein
Look at the gel below • Which colors are negative? • Why? + _
Practice Putting It All Together Which of the following am I showing/describing? DNA mRNA rRNAtRNA Protein
Practice Putting It All Together Which of the following am I showing/describing? DNA mRNA rRNAtRNA Protein
Practice Putting It All Together Reads mRNA and assembles amino acids into a chain: ___________ Which of the following am I showing/describing? DNA mRNA rRNAtRNA Protein
Look at the gel below • Which colors are the largest? • Why? + _
Practice Putting It All Together A copy of the information in DNA that can be taken out of the nucleus: ___________ Which of the following am I showing/describing? DNA mRNA rRNAtRNA Protein
Open binder to Transcription homework. Make SURE YOUR NAME IS ON the homework.Put binder on lab bench in order of last names:
Bellwork 2-6-13 • 1) Summarize the four steps of translation. • 2) What carries the anti-codon?
Translation Simulation • You and your partner will receive an envelope full of mature mRNA transcripts • Take the mRNA out of the nucleus & into the cytoplasm (lab table) for translation • Pull the mRNA through the ribosome, & match up the correct tRNA • Record the amino acids that would be added to the growing chain • Figure out the secret phrase! **If you finish early, work on your translation HW probs
Simulation Run-down • Each tRNA can only carry ONE amino acid (UAC always carries Methionine)….but were there some amino acids that were carried by multiple tRNAs? • Why might this overlap be beneficial?
Short-cut mRNA Codon Wheel Determine an amino acid sequence from the mature mRNA…without having to match up tRNAanticodons! AUG = Methionine (M)
Try it out! Mature mRNA: AUG GAC CGA GUU AGC UGA GAU CUG Amino Acids: _ _ _ _ _ _ _ _ M D R V T stop Complete the amino acid sequence on your worksheet using the codon wheel
Closure- do it backwards Write a short message using amino acid abbreviations: CAR Work backwards to write the mRNA: Add a start & stop codon Write the complementary DNA gene & make it double stranded: UGU CGA AGA AUG UGU CGA AGA UGA TAC ACA GCT TCT ACT ATG TGT CGA AGA TGA
Closure- do it backwards Write a short message using amino acid abbreviations: CAR Work backwards to write the mRNA: Add a start & stop codon Write the complementary DNA gene & make it double stranded: Dear p.2, Can you figure out the secret message? It’s on the top strand… TAC ACA CGT TCT ACT ATG TGT GCA AGA TGA Sincerely, Carlos Caballero Write the DNA gene onto an index card to trade with another class tomorrow! Don’t forget to put your name! UGU CGA AGA AUG UGU CGA AGA UGA TAC ACA GCT TCT ACT ATG TGT CGA AGA TGA