gerek
Uploaded by
51 SLIDES
662 VUES
510LIKES

DNA and Beyond

DESCRIPTION

DNA and Beyond. 2010 PHS. Rashmi Pershad. Objectives. Learn about the role of DNA sequencing and fragment analysis Learn how to look up information on any gene of interest How to conduct a BLAST search How to go from gene sequence to function The $1,000 Genome. DNA Technologies.

1 / 51

Télécharger la présentation

DNA and Beyond

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. DNA and Beyond 2010 PHS Rashmi Pershad

  2. Objectives • Learn about the role of DNA sequencing and fragment analysis • Learn how to look up information on any gene of interest • How to conduct a BLAST search • How to go from gene sequence to function • The $1,000 Genome

  3. DNA Technologies • Methodology • Fragment Analysis • DNA Sequencing • Real time PCR • Applications: • Medical Diagnostics • Forensic Analysis • Plant Genetics

  4. Polymerase Chain Reaction • PCR Movie- Cold Spring Harbor • http://www.dnalc.org/view/15475-The cycles-of-the-polymerase-chain-reaction-PCR-3D-animation-with-no-audio.html • PCR Movie Applied Biosystems • http://media.invitrogen.com.edgesuite.net/ab/applications-technologies/pharma-biotherapeutics/pcr.swf

  5. Microsatellites • What is a microsatellite? • Are simple sequence repeats consisting of 1-6 base pair repeats • How can they be used? • They can be used as genetic markers

  6. Study Microsatellite Instability 377 gels 96 well porous comb gels Data from 96 lanes in 2.5 hours Still had to track create size standards and analyze data.

  7. Fragment Analysis • Rox 350 size standard 0.02µl per sample • Fiveplex Microsatellite Analysis

  8. Limitation of Instrumentation In Cancer Center work with precious archival paraffin embedded patient DNA. Increased sensitivity provides more data from limited sample. Too much sample results in pull up Optimal input of product for us is 0.4 ng/µl

  9. Dye Primer Labeling • 4 separate reactions Taq polymerase dNTPs A A ACCG A And ddNTPS Taq polymerase dNTPs A C C ACCG A C And ddNTPS G ACC G ACCGAC T T

  10. Dye Terminator labeling A Primer Template AC Taq polymerase, dNTPs + ddTerminators ACCG A C ACCGT G T • Advantages • Reaction performed in single tube • Can used unlabeled primers • False stops are undetected

  11. Big Dye Terminators Argon Laser Acceptor Dyes dR6G A dRox C dR110 G dTamra T CCD Camera linker Emission spectra Raw Data 500-600nm filter Fluorescein donor Dye dRhodamine Acceptor dye • Donor Dye absorbs excitation energy from laser • Transfers c.100% to acceptor molecule • Big Dye gives 2-3 times brighter signal when incorporated into cycle sequencing • product

  12. Protocol Sequencing Reaction Protocol Reagent Quantity DNA 1.5µl Primer 1.6µl Big Dye Terminator ready 2µl reaction mix 5X reaction Buffer 3µl deionised water 11.9µl Total Volume 20µl • Set up sequencing reaction in tube. • Keep reagents on ice • Mix well and spin briefly

  13. DNA Sequencing Movie • DNA Sequencing Movie- Applied Biosystems • http://media.invitrogen.com.edgesuite.net/ab/applications-technologies/pharma-biotherapeutics/DNA_sequencing.swf

  14. Raw Sequence Data Start of Sequence Read out to 800 bases

  15. Standard Template on Pop4 80cm Capillary. Run under standard conditions BDv3.1 ( 1µl)- 800-900 base reads

  16. Data from a 3700 in 4hours run

  17. Problematic Template on Pop4 80cm Capillary. GC rich template with and without Enhancer A Big dye Version 3.1

  18. Normal Wilm’s Tumor Exon 9 Mutant C T

  19. What do you do once you have a sequence? • Compare it to normal sequence. • Submit it to a sequence alignment program to assemble sequence • Search database to identify sequence

  20. DNA Databases • When a scientist sequences a segment of DNA, be it a single gene, a gene operon or an entire chromosome or GENOME, the sequence is deposited in an online database. • The most commonly used database in this country is NCBI GenbankOther databases include: • EMBL-EBI (European Molecular Biology Laboratory-European Bioinformatics Institute) • DDBJ (DNA Data Bank of Japan) • These databases contains millions of DNA sequences and exchange information daily

  21. Bioinformatics Tools • BLAST( NCBI TOOL) • Sequence Alignment • Sequence Comparison • Sequence Identification

  22. Pub Med • PUBMED is the NCBI database of scientific literature that you can search with terms of interest, to see what researchers have discovered about the biology of proteins that are similar to your query sequence.

  23. BLAST SEARCH • NCBI allows users to search the databases and perform analyses in various ways. • You can search by name for nucleotide sequences (genes) or amino acid sequences (proteins). • You can search by name for publications about the sequence (recorded in the Science Life literature database called PUBMED). • You can search for similar sequences using the feature called BLAST (by inputting all or part of a DNA or amino acid sequence) and compare two or more sequences.

  24. NCBI Sequence Record • Each sequence record in the NCBI sequence databases is organized into three sections: • Header – general information about the sequence including the organism it came from and the paper in which it was first published. • Features - information about the role of the sequence in the biology of the organism and any changes that have been made to the sequence. This section also includes information like the length of the sequence, the molecular weight of the protein, and any notes that the depositors wished to add. The start of this section is indicated with the label FEATURES on the left. Terms beginning with a / are referred to as ‘qualifiers’. Examples of qualifiers include /product, /gene, /locus_tag, and /note. • Sequence – nucleotides listed in order and numbered. The start of this section is indicated with the label ORIGIN on the left.

  25. Reference Material • http://www.pseudomonas-syringae.org/Outreach/Module_4_Web.htm • http://www.digitalworldbiology.com/BLAST/slide1.html

  26. Questions?

  27. Question 1 • 1. How can you search Genebank for DNA sequences that are similar to your gene of interest? • a) Google • b) PubMed • c) MySpace • d) BLAST

  28. Answer D BLAST

  29. Question 2 If your E score is = 0 • a) The sequence is 100% match • b) The sequences are not alike • c) There is limited homology between sequences • d) Sequences are highly homologous

  30. Answer A The e score shows the “expected” match value. The lower the score the more significant the alignment .

  31. Question 3 • What does PCR stand for?

  32. Answer • Polymerase Chain Reaction

  33. Exercise 1 You will: • Copy the sequence provided in the box on the Blast page of the NCBI : • websitehttp://www.ncbi.nlm.nih.gov/genome/seq/BlastGen/BlastGen.cgi?taxid=9606 • Identify the name of the gene, • Provide the title of the publication where the sequence was first published, the name of the journal authors and the full title of the article. • What did you learn about this gene?

  34. Exercise 1 continued • You will be provided with a list of sequences that you can use to perform BLAST searches. • For each sequence provided you will answer the questions from the previous slide. • If you need to review a BLAST tutorial you can find one at: http://www.digitalworldbiology.com/BLAST/slide1.html

  35. Sequence 1 TCGAAATAACGCGTGTTCTCAACGCGGTCGCGCAGATGCCTTTGCTCATCAGATGCGACCGCAACCACGTCCGCCGCCTTGTTCGCCGTCCCCGTGCCTCAACCACCACCACGGTGTCGTCTTCCCCGAACGCGTCCCGGTCAGCCAGCCTCCACGCGCCGCGCGCGCGGAGTGCCCATTCGGGCCGCAGCTGCGACGGTGCCGCTCAGATTCTGTGTGGCAGGCGCGTGTTGGAGTCTAAA

  36. Sequence 2 • GTTTATTAGTGATCATGGCTAAGTTTGCGTCCATCATCGCACTTCTTTTTGCTGCTCTTGTTCTTTTTGCTGCTTTCGAAGCACCAACAATGGTGGAAGCACAGAAGTTGTGCGAAAGGCCAAGTGGGACATGGTCAGGAGTCTGTGGAAACAATAACGCATGCAAGAATCAGTGCATTAACCTTGAGAAAGCACGACATGGATCTTGCAACTATGTCTTCCCAGCTCACAAGTGTATCTGCTACTTTCCTTGTTAATTTATCGCAAACTCTTTGGTGAATAGTTTTTATGTAATTTACACAAAATAAGTCAGTGTCACTATCCATGAGTGATTTTAAGACATGTACCAGATATGTTATGTTGGTTCGGTTATACAAATAAAGTTTTATTCACCA

  37. Sequence 3 • CTCGAGACTAGTTCTCTCTCTCTCTCTCTCGTGCCGCATCTCACACCTGTGGATGGACGGCAGCTGAACCGCGGGAAACTTTCGTTCTCACTCTACCTAGATGAACTTTAGTTTATATTAAACACGCGTCGACTCCCACACAAACCGTGCTCGTTTTACATCTTTGTCTCCGCTTTTGAAAACGAGAAGTTGAATTCGCAAGACGCAACTTTCCAGCCCCTCACTGAGCGGGCAGAGTCCGTGAAGCGATGGAGCCGTCCGTCATTCCCGGTGCTGACATACCCGACCTTTACTCCATTAACCCGTTTAATGTCACTTTTCCCGACGACGTTTTGAGTTTCGTTCCTGATGGGAGGAACTACACCGAACCTAACCCGGTAAAGAGCCGCG GAATCATCATCGCCATTTCCATCACCGCTC

More Related