Bio-Identification of Flake Samples Using DNA Barcoding
Is flake fake ?. Bio-Identification of Flake Samples Using DNA Barcoding By Lina Martinez, Jeremy Tallman, Richard Moloney , Chantall Smith, Joanna Wisniewski , Wathsala Kumari Katherine Te. INTRODUCTION. DNA BARCODING.
Bio-Identification of Flake Samples Using DNA Barcoding
E N D
Presentation Transcript
Is flake fake ? Bio-Identification of Flake Samples Using DNA Barcoding By Lina Martinez, Jeremy Tallman, Richard Moloney, ChantallSmith, Joanna Wisniewski , Wathsala Kumari Katherine Te
INTRODUCTION DNA BARCODING • Provides a faster method of accuracy determining a species when compared with morphological identification. • It allows for how species are assembled within a biological systems . • Determine the composition/purity of biological samples . • The DNA Barcode used here is a section of the Cytochrome c oxidase 1, a region involved in the electron phase of mitochondrial respiration.
AIMS • Our group decided to determine if DNA Barcoding could be used to identify which species of shark are sold in Australia as “flake”. • Hypothesis – that different species of shark are sold under the banner of flake
MATERIALS AND METHODS Primer sequences used in the experiment were: • “A fragment from the 5’ end of COI (~ 648 base pairs) is isolated (the entire gene has~ 1500 base pairs).” • COI barcoding (fish) 5’-TGTAAAACGACGGCCAGTCAACCAACCACAAAGACATTGGCAC -3’ • FORWARD PRIMER – VF2_t1 5’-TGTAAAACGACGGCCAGTCGACTAATCATAAAGATATCGGCAC-3’ • FORWARD PRIMER – Fish F2_t1 5’-CAGGAAACAGCTATGACACTTCAGGGTGACCGAAGAATCAGAA-3’ • REVERSE PRIMER – Fish R2_t1 5’-CAGGAAACAGCTATGACACCTCAGGGTGTCCGAARAAYCARAA-3’ • REVERSE PRIMER – FR1 • For other materials and methods refer to Project Manual (Diploma In Laboratory Techniques MSL50109)
RESULTS FROM OUR (PCR) • We had DNA of of about 580 base pairs which was the expected size.
RESULTS AFTER PCR • CONSENSUS SEQUENCES • FLAKE SAMPLE - Galeorhinusgaleus • TGGGACAGCCAGGATCTCTTTTAGGAGATGACCAGATTTATAATGTGATCGTAACCGCCCATGCTTTTGTAATAATCTTTTTTATGGTTATACCAATCATGATTGGTGGCTTTGGAAATTGACTAGTTCCATTAATAATTGGTGCGCCTGATATAGCCTTCCCACGGATAAATAACATAAGCTTCTGACTTCTTCCACCATCATTCCTTCTTCTCCTAGCTTCTGCCGGAGTAGAAGCTGGAGCAGGTACTGGTTGAACAGTATATCCTCCACTAGCAAGCAATTTAGCCCATGCTGGACCATCTGTAGATTTAGCCATTTTCTCCCTTCATTTAGCCGGTATCTCATCAATCCTAGCCTCAATTAATTTTATTACAACCATTATTAACATAAAACCCCCAGCTATTTCCCAATATCAAACACCATTATTTGTTTGATCAATTCTTGTAACTACTATTCTTCTTCTCCTCTCTCTCCCAGTTCTCGCAGCAGGAATCACAATATTACTTACAGACCGTAACCTTAATACCACATTCTTTGACCCTGCAGGTGGAGGAGACCCAATCCTTTACCAACATTTATTCTGATTCTTC
…Results Table 1. Results of DNA sequencing
…Discussion GUMMY SHARK http://www.oceanwideimages.com/images/10801/large/gummy-shark-24M2642-01D.jpg
…Discussion – the species found SPOTTED ESTUARY SMOOTH-HOUND http://www.southern-edge.com/rig-shark-or-lemonfish/
…Discussion SCHOOL SHARK, TOPE SHARK, SOUPFIN SHARKORSNAPPER SHARK, http://www.exploreuw.com/Galeorhinus_galeus.d
…Discussion • Our results support our hypothesis. We found 3 different speciesare sold as “flake”. This shows that DNA Barcoding can be used to identify seafood species sold in Australia. • 2 out of the 5 shark DNA sequences was that of the endangered Tope Shark. • The Tope Shark is found on the Red List of the IUCN - The World Conservation Union. • DNA barcoding can be used to help in the conservation of endangered species.
The government has a National Plan of Action for the Conservation and Management of Sharks 2012 – Shark Plan 2 • It aims on working on conservation and managing Australian Fisheries. • Our data suggests that DNA barcoding could be a good method to assist this plan
….Discussion • For future experiments a bigger sample size would help to discover how wide spread endangered species are being consumed and labelled as “shark”. • The larger the sample size of shark being tested, the more we can have confirmation of our results. • Our results agree with the results of the students from New York’s Trinity School who did an experiment on ‘mislabelled’ fish.